Description :
From Genome Similarity Track
Location :
Scaffold_1688:382- 5274
Transcript NameFunction/comments
Phyag_g11266hypothetical protein PHYSODRAFT_299225
Phyag_g11267hypothetical protein

Sequence
4892 bases(100 bases per row)
GAGCCTTGTTAACCCACGCCCAAGCAGTTTTGTACGTGATCCCGTTGTGTGATGCGATGAGAGACCAATTACGACCTTCTttggcagcgtcgaggacACG
ACCGCGTTGATCGTCGGTGTAGCGCTTGTACCCCATCGCAAATGGAGgaatgaagaagcttgtACAACCACTGATGCTGCGCATTCTAGAATGATCGAAT
CTACTTCTAAACCTAATTGAGGTCCAAATATAAACTTTTGGCGGGGTTCTGAATTTGATCTGAGGATTTCTGAATTTGATCTGGGAAATTCTCAATTTGA
ACCGGAAATGGTGTACTAAAGTCATAGAACTACATACTTATACTCAGGCGAAGGGATTCGCTGCTTGATACAGCGCGCCCTGTGATCTATCACACTGGAA
ACATGCTTTCTGTTTTGTTTTTGAAACGCAGTAAAACGCTAGCACAGGTATACATAGAGTAGGAAGGTAAGTCAACACAGTGTTTGGCAGCAAAAGCCAC
CTGTGGGGTACTTGGTATATTGTTAACTGAGGCTTctctcgagttctgcttctcaCTATTGTCATACACTTAAGTTGTAGTGTGTACTTTAGTGGAGATC
AGTATAATCCTCAACAGCCCCACCTACTGATCACCAGCACTACATCTTCTTTTCCCGAACTCGACTTTCGACATCAGCCCCATAGTTTCACGGTGCTTCT
CAAAATTTacacgaggaagaggcttGGTGAAAGCATCGGCAACGTTTTCCGAACCCGGAACTCGTAGAACACAAATCTCCTTCGGCTCCACACGTTCCCG
TACAAAATGATGCCTCACATCAATATACTTTGTGCGGTTGTGGATCGCTGGGTTGttcgccaacttcttggcgctctCATTGTCTACGAAAACTTCTGAG
GGTTCTTTCTGCTGTAACTTGAGCTCTTTCAACATCTGACGTAGGTGAAATACTTCTTGTACAAGTAAACTCGGCGCCATATACTCTGCCTCAGTGGTAT
GAAGTGCAACCGTCTTCTCAGTCTGACTACTCCAAGAAATTGTACTTCCACAAAATTTTGTCAAATAGCCAGCAACAGACTTTCGGTCTTCCACACGGTT
TGCAAAATCGGCATCAGCAAATGCTTGTTCAGTGTTTGATCCATCCACTTATGTCCACCAAGACATAGTCCAAAGTCTAGTGTCTCTCGTAGATACCGCA
ATCCACGTTTGGCAGCTCTCCAATGCAGTATTCCTGGATTCTCCAAGAATTGACTACACTCACGCACGAGAAATGCTAGATCTGGACGTGTACCTAGCAT
CAGGTACATCAAACTTCCAATGACTGAACGATATGGCTTGCTGCTCATAAGTTGTCGTTCATCATTTTCTGTAGGACACATGGCCTTGGTTAGCTTCAAG
TCTGATGTGCTCGGGGTCTTACACCCATTACAATTTTCCATGTTGAATCGCTGGAGCACTAAGTTTGCATATTTTTCTTGGCCAATGAATATTGTCCNGA
TGAGCTTCATCGTAGGAGCAAACAAAATCAAATCATCAACATAGAGCGATATGAACACTAAGTGTTCACCAATCACTCTGACCGCAACACATGCTTCTGA
TTGCAGCATCGTGAAGCCTTGCTCCTTCAAAAAATTCTTCGACAATTGGAACCACACTCTTGGAGCCTGCTTTAAACCGTACAGGCTTTTAAGCAAGTGA
CAAACCCAGTCATCTTTGCCCTTCACACAGTATCCTGCAGGTTGCTCCATATAGACCTCGACGTCTATCTTTCCATTCAAAAACGCAGTTGTTACATCCA
TTTGATGTACTTCATAGTTCCAAACTGTTGCAAGGGTCAAGAGAACACGCAGTGTCTCTAGTCTCACTACAGGAGAGTACACTTCTAGGTAGTCAATACC
GTATTCTTGCATAAACCCCTTTATCACTAATCTCGCTTTGAAGCGTTCAACTTCTCCACTCGCGAGATATTTCACACGGAACACCCAACGATTCTTTAGA
ACTTTCATGTGATGCTGACGTGGTACTAGCTCCCAAGTACCATTTTTCATCAACGCATTGTAttcagcatcagcagcagttTTCCACTGCAAGTGGTGTT
CACTTTTCATCGACTCATTCATTGTCACTGGCTCAGAGATCACTGACATCGTCATACAACAGTAGCCCTGCCACCATGCCAGTACTACTTCTTTTGCCAT
AGCACGCTGGAGATCTGTATGAGCTGTTTTCCATCCAGCAGACGATGTGCTCAAAGCACCATAGGAATTTGCTCTCTCATAGGCGATGGACAAACAATCA
CCAAACCACTTCGGTGGTTTACTCACACGGCCACTTCGAGTTACTGAATGGCCCTCAGTACGAGCTCTTTTTGGTGCCACGTGCTCGCGCAACACTCTGC
AAGTTGAGGTCGATAGCCTCTCATTACTTGCCTTTCTACACGGTGCTCCCTCGTCAAAATCTGTGGTCGTTATTTCACTCGACTCTGAAGGAACAAGCCG
CGTCACATCTCGTACATCACCACCATTTGTTTCCAGACTCTCTGGAAGTGGTTGTACCTCTGCAGCCGGTGACATGCGCCGCCGACTGCTTCTATATTTC
TCTTTTTGTTTGACACTCTTCGGTGTCATGTTTTGTGGCACGCACTCACCTCTCAGGTGGTCTGCCCCATTGTAAGGCACGCACTCACCACGAGGGTGGT
CTGCCTCCGAATGCTGCCCTGTGTCACGCACAGACACCGTACCCGAAGTACCAGTGCTACTTGGCATTGCAAATCGGATTCGTCTTTGAGGTTCTACGAT
CTCTGAGGCGCCACTTCTGGCTCGACCTCGTTTGGGCTGAGGCTCTACGACCTCTGAGTCGCCACTACTGGCTCAACTCCGTTTGGCCCCACCTGACCGG
GCACTACTCCCAACAGCCCCACATGTCCGGTCATCCGTCGCGCTGCTTCCTCCCCCACCTGTCCGAGAATCAACTTGGTTGTTGGCAGCACTACCATCAC
CTACAGTCATCTCTTCGAGCATCTTTTCGCCTCTTGCATTGCCAATTCCGAAATACTCCATCGTAGGAACTGCAcgagatgctggtggtgattCGGTCAA
TAATCGGCCAGCTTTGCTATCATAAAACACAACAGTGTGGCTGTAAAAGGCTCTGTGAGTCTTGCTATCCAACAATCGATAGCCTCTCCGGCCACGTGCG
TAGCCGACAAAGACTGCTTCTCTAGCTTTAGCCTGCATTTTTCGACTCTCAACTCTGTCCACATATGACAGCACTGCACACCCAAAAGTTCTCAACTTGT
CATATTCCGGGTTTTTCGATGCCGAACAGCATAAGGCACCTCCATTCCGCGAATAGAATTGGGTACAATGTTCACGCAGTGTGCAGCTGTCACTGCTGCC
TCGCCCCACATTGCTTCAGGCAAATCGAAGTGAACAAGCAGGCACCGCATTCGCTCAGTGATCGTTTGGATCATTCTCTCGGCCACTCCATTTTGTTCAG
GAGTATGCTTCACACTACTCTCAAATTCCATGCCACGTTTTGCCTCCACCGTGCGCTGAAGATATTTGAACTCCTTGGCATTATCCGACTTAAAGCTTTA
TATGCGCACGTGTAGTTGAGTCTTCGCTAACTGGTAGTACTCCTCAAACTTTTCATAGACATCCGAGCGACGTTCAAGTAGGTACACCGTGACAAACCGA
CTCGCATCATCAACAAATACCGCTAAAAAGCGTTTACCACCAAACGATGGCTCTGCATATGGGCCCCACGCATCCACATGAACTTTTTCACCGACTAACC
ATTCTCGAGATTGCGTGCTCCACGGCTTAAAGCTTCTTCTAGACAGCTTTCTCTTCATACAAGTATCACATCTGAAGCCATCAGAGACACGCAAATTCAC
ACTTGTCAATGGCCACTGATCATTACTAAACAGTGCATTGAATGCGTTTTTCCCAGGGTGCCCTAATCTTGTATGCCACAGATCCAAACTCCGAACATGA
GCTGGCACTGCTACCATTGCCACGGTTTGTGGACTTTCCAACTTCAAATGGTAGAGATTGGTACTATCCACGTGAGCAGTAGTAGCTCCGGACGATAAAG
CAATATCTGCATACTCAGGTTCATCGAAGTGAATTCTGACACGATCTCGATCTGGCAAAGATTTGCTCACCTGACGACGTACAGAATACAAGCTGCACTG
CAACTCAGGGGCATAACGAACTCCATACATCGTTATCATGCATCGACCATGAGATGTCTCCAGTTCCTTTTTCACAGTTCCAACACCTTCCACACACAGA
TAATGTTTGCCTCCAACTCGCACTCGAGCACTCAGCCGCGTGAATTCCACAAAGTCTGTCATCTGGTTTGAGATGTGGCTCGAAGCTCCTGAATCGAGAT
TCCAGTTATCGTGTGCTATTCTTGCCATCGGCTTTGACATCTTCACGAtctgctcaagaacaacgtACGCGCTATCATCACTTTCATTGCCGTAGTGGAC
CTTATCGCTAGCCTTAACAGTCTTTCCACCACTCAACTTAGCACGTTTTTGTGCTGGGTCGCCGTTCGATTCCTCCGTCGGCGGGCGCCTCCCAAGATAC
GGACAATTGAACACTTGATGCCCAACCTCTTGACAGTGGAAACATCCACCACTTTGCTGCTTTCCATCGTTGTCCTGAGCTTGTCCAAAATCTCGCCTTC
CACCTTGATTGCCGTGACAACCAAATCCGCGATCAGCAAAACCCCGCCCTTGGCTTCCACCCCGACCACGACCTCCTGCAAAGAAGGCTTTCTGTTCATC
ATCACGTCTGCCGCTATCCGACTTTCTTCCTTGTCGATGGTCGAAGGCCATTTCCAGTGCGAGCTCAAGCCGCTCATAATTCGGAGGATCAT