Description :
From Genome Similarity Track
Location :
Scaffold_2165:382- 2875
Sequence
2493 bases(100 bases per row)
TATGAGGGCGTCCGTGCCACAAGCGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAGGGAGACAACTCCCATGATGAGTTC
GACCCAGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCGCAGCCGGGGCGGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAG
CCATATCGGACCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATTAGGC
GTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTACCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAGGTGGCCG
GATTTGCTGCGCAGCTTCCAGACCCAGTTATGTGAGATTGAGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCACTA
GAATACCTGCATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCACTTCATCG
AGACGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGTTACGTCTTCCAGACGCAGATGTGCTCGCGGGCTGTGGATCGCGCGAAACACCGCCATA
AGAAGGCGGTGGTCGGATCCGGCAAGTATCGCCAAAGGGCTCCGACGCCCACGGCCCCAGCTCGACGTGTCCACCTAGTCACGGCGCCCGACTCAGGAAC
TGAATCAGGATCCGACGGTTCGGACTCCGACCCAGAGGATTACCGTCGAGTCTGTCTCACTGCATCCAACGATCGAACGGCGAAGACCGAAGACAACTCG
CGGTCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGACAGCACAAGTCGGGTGCTCGCAGTGCGGATCCCGGA
AGCACACAGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGAGATCATTGCTTCTACGTGTGTCGCGGGTGTGA
CGAGATTCACGACGTCGGCAAGTGTCCGATGGAGGAATTCTACAACCAGATCCGCCAGTGGTTTGATCCAGCCAAGCACAGAGGGATGTTGCCAGAAGTG
GCCGAGAAGATGTAAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATTGCT
AGATCCAGGTTGCAGGACCCTCGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCTAAGTGGATGAGTTT
TCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGGGGAGAGGCACGTGGTTACTGGGAGAAGCGCCAACATGGTCGATGGTTTGAGCCTACCAAGG
GTGAGGTCACTGCGGATCCCCCTAAGGTCTGTCAGGTCACTGGATCCCGTGGATCTGACGAGGTGGGATCCATGGATCTACTAACCGGGGAGTCCCGTGG
ATACTGGAAGTACCATGCCCCAAGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCTAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCC
GAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCAGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACC
GTACAAACGGGAGAACGCGAATCAAGGTCACGTTGGCAGGTTGTTTGGTGTACTGGTTCGATATTTGGGTTGGAGATCTTGCTGGTCAAGACGCCATCCT
CGGAATGGATTTCATGGTACCAGCCGGAGTGAGGTTGGATCTGGCGGATGGGGCACTTTGTTTCCCTGACGAGATGCGGATCCAGCGCAGCGGACGGCGA
CCGTTGTATGGGGCGAAGATGAGAATCATAAGGGCGGATAAGACCACCTGGATCGAGCCCGGGGAAACTTGGGAGCTGTCAGACCGGTTAAAGTGGGTGG
AACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTGCCTACAGTAATCCAAGGACCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGA
CAAGAGACTATTACTGGACCATTATGAGGAGATCGGGCGATGGCTGGCGAAGGACGGTATCCCTGGGCGACCTGGATATGTGTCAGTGGGATCCCGTCGT
TACCGAGAATGGCAGAATCTGGCGTATGAGGCGACTACCGAAATCGAATCTCTCGGAGAGGTGGAGCTCCCGGTGGGACCAACTGACCCCTTGGTGGATC
GGCCTTCATATCCAACTCCGCAAAAGATCCTGCAGAGGGATCGTCAGATTGAGGTCCAAGCGATGGAGGCCGGATCCAAGACCGGGGATGATC