Description :
From Genome Similarity Track
Location :
Scaffold_394:382- 2081
Transcript NameFunction/comments
Phyra_85960endo-1,3(4)-beta-glucanase, putative

Sequence
1699 bases(100 bases per row)
CGGCCGGGTGGCTGCAATGTACAGCGCCCAGGAGCGGGAGAGCCCGTCATCCATCGTGACGTTGCGCAGCTTTTCAAGCGCGAACGCCTTGTTGACGGTG
GCGTAGTTCATGTAGAGAAGCGAGAGCCACGGGTTGGTCTGCTCGTCGTTCTGGACGATCGGCTCGCGCGACAGGACCTGGTCCCATTCCTGTGAGACGA
AGTCGTGCGTGCGCACAAACTCGGTGACGGCCGTGACTGGGAGCATCTGAATGCCGTGGATCGCGTACTTCTCGCCGCTGAACCACGTCGCGTAGGTGAC
CTTGTTGTCGAAAAGGATTCCCATGACCTTGTTGTCACGGTAGCGGTCCGGGTGGGCGCGGTTACCGTCCTCGATCAGGAAGTACGTCTGGATCGCGCGG
GCGTTGAGCTTGACCATGAGCTTGCCAACCGTTTCAAGGTGGGCGTCGCCTGTGGCCTTGCCCAGCAGTGCCATGCCGTAGTAAAAGTTCATGTCCTCGG
ACGTGCTCTCCTCGTCCTTGCCATCTCCAAGCGCCGTGATGCCGTGCGAGTACGAGTGGCCACGATACCAGTCAAGGCTGCGGAACTTGGGGAAGTACGG
GTCCGCGTCCGACGGGTTGGCGACGTCGCGCACCAAGAAGCCCGCCATACGGTTCAGCTCGGGCAGCTTCGACCAGGTCGGGTCCAGCTTGTTGATGATA
GCGACGGTGACCACCCAGTAGCCGTAATGGTAGTGGTGGTCGTTGTACATGGTGTTGCCAAAGTCAACGTTGGCGTCGTGGAGCGTGAAGCCCTGCGAGC
TCACCACACCACGATAGATAGTGTCGTAGTTGAGCGCGTTAGTCCACGTGTTGTTCAAGAACGGCGTGAGCATGCTCTCCAACTTCTTGATGCAGTGCGG
GAGCAGCGTGGTGTCTTCGCCGACGATGGAGGCGTCTCCAGCCATCAGACACATCGACGCGTACTTCTGCGCGGCCTTGCCATTGAAGTAGTAGCTCTGG
CCCAGGGGGATCGACCACTCGGACTCGATATCGGCGATGAGCGTCTTCTTAATCTTGTACGACTCGACATCGCTGGCATCGGGTTTCCGCGGCGGGTAAA
AGTCAACGGGGAAGTCCACCGTTTCCACAAGACGCCACTCGGGCGGCGCAGTCTTGGTCACCACTCCCTGCATCAGTCCGCGCGTCGTGGAGTGAGCAGC
TACGCCTTCAGCCTCCACAGCGTATCTGCGATCCAGCGTGTCGATGTGGTGGACCTGGGCGTAGTGCAGCAAACCGTTTCCACAGTCGCCGCTGGTCTTC
CACACGTACGCGTAGGCGTCTTCATTGTGGGCTTCAACACGGCCACCGTCGAGGACGCAGCCCGCCGTCTGGTCGAAGACGTTCTGCTCTTGCGCAGAGG
CATCGGGGATCAGCGCAACACGAGCAATGCCAGTGAATGGGCGCTCCATGTCGAGCACAGAGTGGCCATCAAAGTGCAGCGCGACCGGAGAAGAGAAGTA
CAGCGTCCAGGTTGCGCCGTTGTCGAACTGCAGCACGAAGCGGCTGTTGGTAAGAGGAAGGCTGACGGTCTCCGTGGCGTCCAGGCCGTTGATGGTCGAG
ATGTTGTACGCCGTCTGGAACCGCGGCGTCAGCTCAGTGTATCGAGCAGTGACGAAGGCCATGCCGCTTGCGAGAGTCACCTCGATCTTCTTCGCATCA