Description :
From Genome Similarity Track
Location :
scaffold_56:38191- 39515
Transcript NameFunction/comments
Plaha_PHALS_04300lysosomal alpha-

Sequence
1324 bases(100 bases per row)
ATTCTTCGGATGCGGTTAGTGTTCCTATGGATAAAGTATTATGAAATTCTTCAGTGATCAGCTCTGTTCTGTGTTGTGTACATTGGTACAGTGTACACGA
TTCTGCAAGACCCGAGAAGGCGCTTATAGATGAGGTGCTCAAGGAGCAAtcaaacaagaaaaaagaCAAGATTGATTTCTTAACAAATGTCGTATATAAA
CACTGAAAAACAAATTCGACGCTGTTCTGTTTGGAGTTCACATTTTGTACAAACACTTTTTCGTGACGCAGTTTTAGGAAGTCTCAGAGCAAATACCAGG
ATAGCTTTTTCCACCAAAGCGAAAGATTTGTACTCAGTTTGGCAGTATTCAGGTATTTGTATCAAATGACCGCCTAAATAGAGTAGCTGGTTGCTGTATG
CGAAGACATGATGTGCACCATTTTTCCTCTAGTCGtcctcttgaaatttctgctGAGTTTAAGATAATGTTAGTGATGGCATAGGGCGATGGCGTGCATA
TGTATCAGAACTAGTATCTTTAACCCTCAATTCATATTTTCGTCGTGAGTCAGTATATTTGTATAAATAAATGAGTTGAAGTAAAAGATCGCGAAATCTG
ATCTCTCCCTTTCACAAAACCATACAAAATTCGATCTGCATGCTCGTGATAAAAGCTCTTGTGACGTCTCTGTGTGCTGGCTCTGCCGCCGCCGCCTCCT
GCGACCCAAGAAAATGGACGCCTTCGACTGATGGGGTTTACAACACGTCAAGCCGTGTGGTCCCGGACAAGTTAAATGTGCATCTTATTGCACACTCGCA
TGACGATCCTGGATGGATCATAAATGTGGATCAATACTACGTCCAGAGAGTACAGTACATTCTTGACACAGCAGTAGAGGAACTCATTCGTAACCCAGAC
CGCCAGTTTATGTTCGTAGAACAGTCGTTCTTCCAGCGCTGGTGGCACGAACAGGGGTCTGAAGTACGTAACGTCGTCAAGCAGCTCGTGCGTGAAGGTC
GCTTGGATCTTACAGTCAATGGTGGATGGTGTATGCACGATGAAGCTACACCGCATTACATTGCCATGGTGGATCAGACGTCGTACGGTCACCAGCTACT
CATGGATGAATTCGGTATCAGTCCGCGTATAGGGTGGCAAATTGATCCGTTTGGACACTCGGCCACACAAGGCTCACTACTGTCGCAAGGTATAGGCTTC
GATGCTCTATACTTTGCTCGTATTGACTACCAAGACTATGGAAACCGAAAGAAAAACAAGGAGCTTGAATTTATTTGGCGTCCCAGCAAGTCGCGCGGCA
AGGCATCACAAATCTTTACTGGAG