Description :
From Genome Similarity Track
Location :
Scaffold_24:38187- 39338
Transcript NameFunction/comments
Phypa_INRA-310PPTG_11260hypothetical protein

Sequence
1151 bases(100 bases per row)
CATGAATGCTAGCAACGTCAAGTTCCCTCTGCCGGACGGGTATTTCCCGCCGGTAAACCTTACGCCGGCCGAGATCGAGGTATATGAGCAACGCGTGGAG
ATCATCATGAAGAACGCACTAGCCGAGTACAACCTGCACGAGGCTATGGGTGCTCGGCCAGACTACGGTTCTCGCTGGAGCGTAGTGGGCAACGTCGAGC
ACCTCACTGCTATTCGTGAGGTCGATCCGTCCAGGGCAGTCGAAGCTTCGCGCATTTTCGGCCGCGTGGACGGCGACTACCGCAACTTTATCGACTTCTT
CTACTCCGTTTCATCACAAGAGGTGTTCGCCGTAAACCAGTTCATGTATGGATACGCCGTGGATGCCGCGGTGCTGTGCAACATCCACACGAAAGAATCC
AACAAGCCGCACCAATATCTGGGCATGAAATGGGTTTGTCTGCAGCCGTCGTCGCTCTCGCGCAAGCGCGATATGTGTTTCCTCGAGTATCTCGTCTACA
CTAAGGATCTACAGGAACGAGACGTCGGTGTCCGTATCACGCTGCCTCTGATCCTGGATGAGTGTCCGCCGCTGCCGGATAAGCTGAAGACCCGGCGAAT
TCACACGCACACGGTGACAATCGTTCGTCCGACGAACGACGGCGCCGACGCTACTCAGATCTTCTCGACCAGCGAGGTCGACATGTACAAGGGCTCGAAC
TCTTCATCAGTTGCTACTTTCAAAAAACTCATGACCACACTGAGTTCTATGGCGTTGTTTGCGGACTCGAAGCGCATCTCGATGCAAGGCATGCTGGATC
GCAGCAGTTGGGCGCCGAAGAAGGCACGCGCCAACTGCTCCGTGTGCAACCGCAAGTTCTCCCCCACGCGACGCCGGCAGCACTGCCGTCTCTGTGGTGA
AGTGGCTTGTCGTCGTTGCATGACGATCCGTGACGCCCCAATGCTTGATGACAGTGCTTCTTCACCTGCCCGCACGTTCCAAGTAGTGAAGACCATGTTC
TGCAAGGCCTGTATGGGTAAGGTTCGCGACTCCGACACCAAAAGCATCGCGGGGGCTGACAGTCAGGACGAAGGTGCGTCGGATGCCGAGTCCACCGGTT
GGTTCGCGGACAAGTCCCGCAGCCGAAGCTTTGACAACGAGTACAATAACG