Description :
From Genome Similarity Track
Location :
Scaffold_2:381843- 383640
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G001041Similar to TRA2A: Transformer-2 protein homolog (Homo sapiens)
Pytul_DAOMBR144PYU1_G001040Similar to PAPD5: PAP-associated domain-containing protein 5 (Homo sapiens)

Sequence
1797 bases(100 bases per row)
CTTCGTGCTGGCAAGACGTGGTCCCAAGTCTGGACACAAACATGATACACTCTATTAGTAAGCGCACACATGGGTGTTGAGCAAAATTGACTGTGAGCGC
ATGCATGAACGTACACTTTCCGGGCGTCTTCTCATGACCGCGCTTTCGCTTGGCGTGCTCAACACGAATGCGCCGACCTTGAATCTCCTTTCTGTGATAC
CAGCCACAGAGTACAACGTTAGCAAGTTCGCGTTACCTCCCACTCTCTCGTTGAATGCTACTTACCCGTTCAGCTCGTTCACGGCATCATTAGCGTCACG
AACATCTTCAAAGGTCACAAAGGCAAACCCTCTATGGCAGACAGAAATAGGAGCGCAAACACATTTATCAGCACGCGCGGTAATGAACAGAGGGGACAAG
GGCGGGCGCATGAACCAAAAGCAAGGACGCACCTCGAGTCGCGCGTGACTGGGTCCAGGATCACTTCGCACTTGTCCAGTCGGCCAAACTTGGAGAAGAT
CTCTTCCAAGTCCGTCTGCGTAATCTACAAAAAAACCCAGCACAAATGCGTCAGACAACCGTCCAAGCGCACTTTCCCAGACGACAACTTGAGCAAATTC
GTACTCGGTGGGCTAAGTTGGCGACGTAGAGGTTGTTGCCCGGGTTGGCGGCCTCGGGGTCGACGTCCGCCGCGGCTTCCTTGCTGCGCGCAGGCGAGGG
CGAGCGAGAGGACGCGGCGCGGCGCTCCGAGCGATCCTCGCGCTCGGCGGCGGCTTCTCCGTTCTGGTCGCGCGGCGAGCGGTCGCCTCGCGCGGGGGAC
CCCGTGGATGCGCTCTCGCGCGGCGAGCGCGGCGACTTGGGCGAGTGGCTCGCGCTGTCGTCGTTCTGGCCGGCGTTCGAGGGCGAGCTGCTCCCCTTGT
CCGACATCTCTCTCTCTCTCTCTTTACTCACAAGCGCTCTCTCGTGCGATCGAATGGCGGAATGCGGCGGCTGGTCGCTGCTGCTTCCGTTAAAAATCTT
GGAGGATTGTAATTTTGGGTTTCGTTGCCATTCAAACCCGCGATCGCGCTGCGTCATCTCTCCTCGTTCAATAGACATGCCTTTAGATTTTGCGACGTCG
CCCATCCGAATTGAAGCCGTTTCCGCCAAGGAGGGACAGGCAGCAATACTGACCGGAATACCGGTGTTTACGATCCTTACCGGTAAAGAAACCAGTAGTT
GCAAATAATCAATTTTAGCCAATCGCTGGCGTTGAATGAACTAAAAGTGTTGGTTCCCAGTCATTTGGTTGTCGCATTATAACAAGGTGTACAACCATGG
CGCGCACGAAGAAGGCGGCGCGCAGAGTGGTGCAGGCCGTGAAGGTGAACGCGGATACTGGCAATAGCAAGAAGAAGGCGGCGGGCGTGGACAAGAAGAA
GGCGAAACAGAAGCTCAAGCTCAAGGCAAAGGCCAAGTACGCGGCCAAGGTCGCGAAGGAGGAGGAGAAGCGCGAGCGGCGCGAGCTCAAGCGCCGATTG
AACGAGGAAGAGGAGCACGACACCGAAGACGGCACCGACGACGACAATAATGACAATAATGACGAGGAAGACAACGGATTTATCCATATAGAGACCGAAG
AAGAAGCACGCAACAGCAGCAACAATGGCACAAAAAAGGTAACCGACAGTGCCGCCGCAGACGACGTCGAAGACGGCGAGGAGGAAGACGGCAGTCGACT
GATGCTCGAGGCCATGCCCTGGATGCGCCAGCGCACAGGCTACTACAACAAGAATCTGTATCTGTGTCTGCACGAGGAGATCATGGACTTTGTCGTG