Description :
From Genome Similarity Track
Location :
Scaffold_155:3817- 5400
Transcript NameFunction/comments
Physo_143861hypothetical protein

Sequence
1583 bases(100 bases per row)
ATCCTGCCCGTGATCTTGCCACCAGTCTTGCGGCCGGCGATCACGTCCATTAGCGTCGTCTTACCGGCACCAGTAGAGCCCATCAGCGCAGTGATCGAAC
CGGGGACAGCGTAGCCGTTGATGCCCTTGAGCAGCTCGAGTTGCTCCTTCGGGTTGTGAGGGTCCGGCACCCAGTAGTGCAAATCCTGGAATGCCACAGT
CACCGGGATGAAGTTCTTCTCACGAGTCTCGACAGGTAGATCCACAATCACGTCGCCCTTCGAGTTTGCCGCCTTTGGAGTCTCCGTGAGGAAGTACGAG
TTGTTCTCATCCTCGACAGGCTTCACCGACACATCCACCGTTTCCGGTGTTTCGTAGCGGACGTACTCCATCGCCAGGTACGACAGGAACATCAAGAAGA
CGTACACGGCCAGTAAGTAGATGATGGCGTACGCGACCCACTCCTTCTCCGTGGCGATACCGAACAAATTCAGGTAGTACTCGCCCATGTTAAGACCGTC
GTACTTGGCGCAGTAGTCCACGCCGTCGTACACGCACACGTCGAAGTCGCTGGAGCGGTACTGGTTGATGGCCAGCGCCTTGAGAGCCCACGCAATTGGG
CTAATCCAATGCGCCCAGATGAGGTAGTCGGGAATTTGGCTCTTGGTCACGATGAAGCCCGCGAAGATGATGAACACGAGGATCGAGACCATGCCCACCG
GCATCACCACGTTGGCGTCGGGCAGCGCTCCAGCGAGGAAGAAGAACCACATGCCCATGGCCAGGTTCGACACGAACAGTACGACCTCGAAGATGATGAA
CAGCTTCACATCGGACGCGAACCCGCAGACCCAATAGACGATCGACCCGAAGATGATGGTCTCGGCCAGCGCCAACGGGATCTGGCTCACAGTCGTCGCT
AGAACGTAGGACCCCGTTCGGAAAAAGTTGGCCCGGCGGTGCTTGTAGAAAATGTCTCGCCCAGCAATGTAGACCGGGATCATCGAGCCTTGGCCCATGG
AGAGGAACATGACAGTGGCGAAGATCACTCCCATGACCACGGAGATCTGCGTCGGGTCGAACTGGTAGAAGATGGAGCAGTAGATCAAGCCCATGATGAT
CACCATCATCAGTCGCCCCATGACGAACGCCTTGTTACGGTACGTGATGAGCAGCGCGCGCCACTGAAGCGCCAGCACACTGGCAAATACAGACTGGTGG
AAAGTCGGCATGGGGTCGATGATGTCCTTCACACTCGCGACCAGCTTCGGGTCATACGGCGCCTCCAGTGCAGCCAGCGTGTTGCAGTAGATCCGAGACT
GGCCGAAGCACTCCGCGAACTCCCTCGGGCTGCGGGGCTGCTTGGTCGGGTGGGAAACCTCGTAGCGGTGCTGCTGCTTCGTACCCAGGTCCAGCAGGTA
GTCGGCGATGTCGCGTCCCGGGGGACACTTGAAGCCCAGCGTCTCGAAGTATTCCTCCACCTGACTGCAAGGTCCGTGGTACATGAGCTCGCCCTCGTTC
AGGATCATGACGTCGTCGAACAGCGAAAACACCTCCGGGGACGGCTGCAGCAAGGCAATGACCACCGTCTTGCGGAGTCGGTG