Description :
From Genome Similarity Track
Location :
Scaffold_24:38169- 39228
Transcript NameFunction/comments
Phypa_INRA-310PPTG_11260hypothetical protein

Sequence
1059 bases(100 bases per row)
CAGCGGCGCAACTCCGAGCATGAATGCTAGCAACGTCAAGTTCCCTCTGCCGGACGGGTATTTCCCGCCGGTAAACCTTACGCCGGCCGAGATCGAGGTA
TATGAGCAACGCGTGGAGATCATCATGAAGAACGCACTAGCCGAGTACAACCTGCACGAGGCTATGGGTGCTCGGCCAGACTACGGTTCTCGCTGGAGCG
TAGTGGGCAACGTCGAGCACCTCACTGCTATTCGTGAGGTCGATCCGTCCAGGGCAGTCGAAGCTTCGCGCATTTTCGGCCGCGTGGACGGCGACTACCG
CAACTTTATCGACTTCTTCTACTCCGTTTCATCACAAGAGGTGTTCGCCGTAAACCAGTTCATGTATGGATACGCCGTGGATGCCGCGGTGCTGTGCAAC
ATCCACACGAAAGAATCCAACAAGCCGCACCAATATCTGGGCATGAAATGGGTTTGTCTGCAGCCGTCGTCGCTCTCGCGCAAGCGCGATATGTGTTTCC
TCGAGTATCTCGTCTACACTAAGGATCTACAGGAACGAGACGTCGGTGTCCGTATCACGCTGCCTCTGATCCTGGATGAGTGTCCGCCGCTGCCGGATAA
GCTGAAGACCCGGCGAATTCACACGCACACGGTGACAATCGTTCGTCCGACGAACGACGGCGCCGACGCTACTCAGATCTTCTCGACCAGCGAGGTCGAC
ATGTACAAGGGCTCGAACTCTTCATCAGTTGCTACTTTCAAAAAACTCATGACCACACTGAGTTCTATGGCGTTGTTTGCGGACTCGAAGCGCATCTCGA
TGCAAGGCATGCTGGATCGCAGCAGTTGGGCGCCGAAGAAGGCACGCGCCAACTGCTCCGTGTGCAACCGCAAGTTCTCCCCCACGCGACGCCGGCAGCA
CTGCCGTCTCTGTGGTGAAGTGGCTTGTCGTCGTTGCATGACGATCCGTGACGCCCCAATGCTTGATGACAGTGCTTCTTCACCTGCCCGCACGTTCCAA
GTAGTGAAGACCATGTTCTGCAAGGCCTGTATGGGTAAGGTTCGCGACTCCGACACCAA