Description :
From Genome Similarity Track
Location :
Scaffold_46:381683- 388838
Transcript NameFunction/comments
Physo_157437MGC80971 protein
Physo_157438hypothetical protein
Physo_136548PREDICTED: similar to Interleukin 1 receptor accessory protein-like 2

Sequence
7155 bases(100 bases per row)
CTGGCGGTCGCTTTGTGTGCGGCTGGTCACCAGAGCCTGAGGACGACTACGACGGACAGTCTACCGACGAGCTCGACTTCCCGGACCACGACCACTTCGA
GGAGCAGATCTGGCCCACGATCGCACACCGTGTCAAGGACTTTGAGGCCATCAAGGTTCTGAGCGCTTGGGCTGGATACTACGACTACAACACCCTCGAC
CAGAACGCCATCATCGGCCTTCACCCCGACGTGCCGAACATGTACCTGGTCAACGGATTCAGTGGTCACGGCCTGCAGCAGTCGCCTGCCGCTGGTCGCG
CCATCTCGGAGCTCATTGTGGACGGAGAGTTCAAGACCATCGACTGCTCGCGCTTCAGCTTCGACCGCGTGCGAGCCAACGAGCCGTTCCTCGAGCAGGG
GATCGTGTAGATGACTAGCTACAAAGTCAGCAGCAACAGTGACGTTTATCCATTAGCAGTACCAGTTGAGCCGCGTTAAAAGATCAATAAAGTCTAGGAT
TCTTAGTGGCGGTAGATACATAGCGAGGTCTTGGTGTTGCTGCCGTCTTGCGGCAGTGACCACGCGTTGTTCTGGTTGGTTTCGCTAAGCTCCTGCACCT
CTGTAAGCCGAGTGTTCACCGAATAAATAACCTGCTTGTACTTGGCGATTTCTTCCTGCCGAAGTCGAACCAGCTCCTCGGCGCAGCGTTTACCGTCACG
AAGTTTTTGGGTGCGCACGACAAGCTGCGCCTCACGCTGTCGCGCCGACTGCTTGTACTGTACAACCAGAGTCTCGTGCTTATCAAGCAGGTCAGAAAAC
TCGGTTTTCAACGCCAACAGCTCTTCCGTTCTATCATCCAGAGCCTCTTTTGCCTTGCGCGCTGCCAGCACCGCCGCGTCCCGCTCCTTGACGGCTGCTT
CTTCCCGTTGAGCATGCAGCTTGCAGTCACTCTTCGCTTCTTGTAATTCCAGTGCAATACGGTGCTGCTCGTTACCCCAGCTTTTCTCCTTCAATCGGTC
CAACTCCTTCTGCTCCAGTGAACGAGACCTCTCGCTGGATGCAGCCGCAAGCTGTTCCTGCAGAGCAGCCTTCTCCTCCCTCGTCGTCTGCAGCGTCACT
TCAAGCTTCTCAATTTTCACTTGGTACTCTGCCACTTTACTTTCCACACCTGTCGACATTTGCTGAGCATTCAGCAGCTCCTGCTTCAGAGCTTCCACCT
TGACTTCATGTTCCCGAGCGATCTGCTGCCACAACTCTCGGACGCGTTTGGCGTCACTCTCCGTGCGTTGCACGAGCTGGTCTCTGTCCGTCTTGAGCTT
CTGAGCTTCTTCCGCGGCTGCTTCGACTTCTGAAATGGCGATCTCCTTCTTCTCGATCTCCTTCTTCCACTTGGTCTCCATCGTCTTGAGCTCCGCCGCC
AGCGTCGTGTTCTTCTGCGTAGCGGCGTTCCTCCCCAGCACCGCCATCTTGTGCATCGCCACCTCGTCCTCCAGCTCCTTCTCCAGCGCTACCTGCTTGT
CCCGAGCTTGTTGAGCTGCTTGGGCGCTGCGCTGCTGCACGTGACGCAGCTCCAGCTCGCGCAGCTGCGCCTCGTTCTCCAGAGTGGCCCTTGCTGCACG
TTCCTGCGCCAGCCGCCGCGTCAGCTCCTCCACTTCTACGCGCAATGCATCCCTCTCGTCCTGCAGCCGGCGCGTGAGCTCCGGCAAACTTCCAGAGGGC
GGAGGGGGCGACGACGGCGGCGTCGGAGCGCCGGGCTCGTCCATTTTTGATACGGCAAGCAACTTTTTGAATTTGAATGAATCAAAAGCTCATTTCAAAG
ACGTTATGGCTACATATATTGGTTTTGGAGGGTAGTGACGACCGCGTTCTGAGTCAAACCTGATTGGTGCAGCCATATCAGTTTTCCGGCCAACTGAAAC
CGTTGTTGCAAAGAGGAACACGCAATTGACGATGGTGCAGCATCGAGTCTCAGCGCCTCAGTCCGCGGGCTACGCGGTCGTTGGCGGGAGTGACGTGCAA
CTGAAGCAGCAGGAGAATGCAAGACCAAGTCCTTTTTGCGGCGTGCAGGCGTGGATATGCGGACTCAGCGCGCTTTCGGGCTTCCTGTTCGGCTACGACT
TGTGTGTGATGGTTGTCGCGCTGCCGCTAATTCAAAAGGTGACGAGATGCGTTATTTGAAGTTTCCACGGAGGTTGTAAACTAACGGATAAGGTTGCAAT
GCTATAGGATTTTGCACTATCGACGACTGCGGCCGAGAGCATCGTCAGTACTCTCATGCTTGGCGCGGTGATCGGGTCGCTCGTGGGCGGTGTTGTTGCC
GACTGGTATGAGTATGCGTGCTTAGTTGCAGTGTTAGGCCAATCATTCTGACTGCAAAAGCATTATGCATTGGTTGATTCAGGATCGGTCGCAAGCCTGC
AAATTTAATTACCGCGGCTCTCTTTCTGCTTGGCTCGCTGTTCATGACATTCGCCGGTTCATTGCGCACAATGCTTGTCGGCCGGTTCATCGCAGGCCTG
GCTGTCGGTAGTAGTGGACCGTGTGTATCCACATACGTAGCTGAAATTGCCCGGCCTAAAACTCGCGGAGCACTCGTTACGATCAATGAGGTGCGTAACG
GTGACGTTTGATGCGATACCTTAGAGGAACACTGGCGCTAAACTAACCAACGACCTGATGTCAGGTTATGGTTTGCTTCGGCTGCCTTGTATCCGTTGTT
GTGAGCTCTTCTTTACAAGGAAGCGAGGTACGCGTAGCAAGCTGAGACGCACTACTCATGAGTACAACTAACGACGCATCTTCTCGTATTGGTTGCATGT
TGCCAGAATGGCTGGCGTGAAATGCTTGGCATGACGCTGTTTCCTCCGCTTGTACAATTGGTCTGTCTGATATTAATAATTGTGGGCATCGGAACCAAGG
CGCATAAGTACTGACATTGTGTGTGTGTGGCATCTCTAGCTTGGAATGCCGTTTCTCCCAGAATCCCCTCGGTGGTTGATCTCGGTACGCACAAGAAGAC
TGTGCCTCTTTTTACTCAACTTCTTGTGAACCTAACATTCAACCCGGCTGAAGAAATATCGTACCAAGGAGGCAAGCGCTGTTCTAAAGAGTTTGCTTTA
CAGCGACGAAGCATCACAAGAGATTATCCAGGCCCACCTTGATGTTGGGGTACAGTACGCACTCCCGCATTGCTGTTGTGGAGGCATCTCATAGCTAACT
CTGTGCTGTTTTCCTGGTGGAGACAGACTTTCCATGAAAGCTTTTTCCACGCGATGAGCGAGCTCGTGACGGATGAACTTACTCGAAAGTGCGTATACCC
ACACTTGGTAGCTTGTGTAGCTCTGTGGCCATGCATTCTAAACATCTTGTGTACATTGCTGTATTATCAGACGCGTCATGTTTAGTGTAGCTATCGCATT
CTGCCACATTTTGACGGCAGCGAACGCGATGCTTTATTACTCTAGCTACATCCTGGACGAACTGCAAACGGGCAATAGTTACCCAGTCTCTCCCCTCAGC
AAAGAGATCTGGGTGGGTATTGCCAAACTTGCAGGAGTTTGCTCGGCTGTCGCCGTGGTGGATCGTGTCGGTCGCCGCCCGCTGCTTCTCATCGGGACTT
TCTTGATGTTGATTTGCCATTTCGTGTTCGCTCTCTGCTTCTGGAGCTTGAGCGCGACGCACTCTGAGTTCGTCCAAACCATTGGAGAATGGAATCTGTA
CGCGTTCATCTTCGCTTGGAACCTTAGCTGGGCGCCGTTGATGTGGGTCGTGTGCTCAGAGCTTCTCCCGGACGAATTTCGCTCCATCGGAATGGGTCTT
ACGTTCGGTATGTTCTGGCTGGGCAGTGCGCTCGTGAACCAAACACTGCTATCAGTCTTCCACGCATTTGGAACTGGAAACGCTTTCCTCTTGTACACAA
CACTCACAGCTGGATCACTTGCATTCGTCTTCTTTAAGGTACGTGAAGCTCAAACTCAAGAACTTACCGACGTATCGTTTCTAATCGAAACTTTTCTGCT
CTGCTGCTGATGTTACAGGTGCCTGAAACCACGGGGCTCACTTTCGAGCAGATCGCTTTGCTCTTCAACGAGAGGGTGGCTCATGTCAGTCTAACTAACC
ATGCAGTGTAGAATGGAAGATAACACACGGCATTCCACTTGAAATTCCATTGGCACTTCAAGGTTTTAGGTTTTCTCTAATCCAAGAAATCCATTGGCTG
ATAGGCTACATCAGTGATAGCAGATCGGGCCATGGCGGTAGCTGTGGAGGATGGCGGACTGTCGGCGGCGCAGCAGCAGCTCGATGAGCTTGAGTGTATG
CTTAGCATGTTTCCTGACGACGATGAACTGAAGGTCGACACGCATGCAAAGGCTGCACTTAAGGCTTACGTCTCTGAAGAGAGCGGGGGTCCGCGACCTG
AATGCCGGATGCAGTACACACTCTTCTACAAGGTGCTTGTGACGGTTGTTGCTTCATTATCGTCAGGATCAAGCTAACAACGGAGTGCCATCTACTCTTG
TGCGGAAGGATCTAGCATTTGGTCGAGAGGTGCCAGCGTTGAAGCTCATTTGCCCTCCAGGATATCCCGACGCTGCGTCGATGGAGTTCGAAGTGCAGTG
TCCTCAGCTCTCACGTCCTCAAATGGAGAAGCTCAACACCGAGTTAGTTAAGTTGGCGACTGCATCGGTTGCAACACAGGAGGTGGTGGGCTTGCAGCTG
TACCAACAAATGCACGACTTTCTATCAGAAATGCACGCCGACGAAAGTATCGATGACCAGCCTGGCGATAAAGCCGTCACTCAGCAGACTGTATTGCTGC
CTACAGTGCTCGGCCGCCGCGCCATCTACTTCCACCACATCATCGCATCCAACAAGCGGCGCGTGGTCAAGGAGTGGGCGCTGGAGCTACAGCTCAGCGG
GTTCAGCAAAATTGGCTGGCCTGGAGTAGTGATCGTCGAAGGAGCCGAAGCCTACGTCCAAGAGTATGTGCGGCGGCTGCAACACCTGCGTTGGAAGCAG
ATAACAGTGCGTGGGGAGCAGACAAAGGAGTTAGGAGAGGGGAGTTCGGGTAGTCTGGACGAACTCAGACGCCTACCACGCGGCTTCAGGGAGTTTCCAG
AGGATGGCATGTCCGACTTGGCGGCTGCGTGTCGCGCTGCGGGTTTAGAGGAGCTCTTCCTCACCACCATGAAAATCTACGGTCGATCTGAGGACGCGCA
ACAAACGAAAGAGGGCGACACAACCAAGAAGAGAGGTAATCGCAGTGGGCGAGTCTAACCATGAACAATGAGGACTGTATGAAAGAGAGGGGTCTATTTA
CACGCGTTGCTTCTTGGCTTTTCCGGTGGCAGCAGCCTTGCCACGCTTCCGTGGCTGCTCCTTGGCCTTCACCTCCTTCTCTTCCTCTGCTTCTGCTTCG
CTATCACTGTCCGTCTTCTCGACGGCCGACTCACTTTCGCCAACCGGCAGCAGGCTCTTCATGGTCACAATACTGAAGTCCACAAGGTACGACTTCTGTA
GCATACGATCGATTCGCTGGAAGTGGCGCTCACTGTATGCGATCAGCGCCTCCACGGTCTTGGAGACTCCATCCAGCGATTTCAAGCGACTAGGCGGCAG
CTCACGAAGAATCGTGCTCACCAGCACTTGGCAGACGCTCGTGTTGCGGGCGTTTGTGTTCCAGTCACGGAGCCAGTCCATAAGCGTCGTCAGCTGCTGG
TCCTTCAAGCTGTGAACCACCGGCGCGTAGATGTCCTCAGGCGAGAAGTTGTCGGGGTCGATAGGCTTGCCACCAGGGAGCGTCGGCTGGTCCTTGTGTC
GCGGGCCTTCGAGCAGGTCGCGCAGAATCTGCAGCATGCGGTTCGGGTGGTTCAGCTCGAACGCGAGCTGAACAGCATCCAGCAGCTTGTTGCTGCGCAG
GCAGTTGAAGAGTTCCTGCTCCTTCAGCAGCTTGGCATCGCGTTCATCCTGCTGCGCGCGCTCCTCCTCCTCGGTAAAGTCACGCCAGAGGTTGATAGTC
GAGTCGGCACCACCGCTGACCATCTCGGAGCTGTCCTTGGACACAGCGAGAGCCCAGATCTTGTCCTCGTGGTTATCAAGAGTCGCCTCGCATTCGTTGC
TCTTGATCGTCCAGAGCTTAACCAGTCCGTCCGCGCCCGCAGATAGAAGCTGCATACCAGCGCAGGCGAACTGCACGTTCAGCACAGAAGCTGTGTGTCC
CTCGAACGTCTTCAAGCACGAAAAGTCCTTAGCGGACCACACCTTCACCGTCTTGTCACCACTAGCCGACGCCAGACACTGATCCACAGGCGAAAACTCC
ACAGCCCACACACCACGCTTGTGTCCGCGGCAAACACCAGCCAGCGTCAAAAGGCGGCCAGCACCACCCTGCTGCGAGTGCCACACCTTGATAAGTTTAT
CCTGCGACGCACTAGCAATGAAGCGATCGTTAGGCGACACCGCGAGTGCGTTCACGTCCTTGTCGTGAGCCTTTACCGCGCCCAGCGTCGAGATCGTCAA
CTCCGCTGGCGCAGGCTTCGCAGTGGCAGCGTAAGCAGCAGCAAGCGGCTGGAGACTCCACATCTTCAGCGTTTTGTCCGAACTACCAGTAACGAAGAAG
GCGGCCCCCGTCGCGAAGCTAGACGCACGCTGGGAGATAGCAACCGCGCCAAGGGCTTCAGTGTGTCCGGCACAGGTAGCAACGCAACGCGGCAGGGTCT
TGTTCATCTTTTTTCCACCGTTAGGCCGCAAGTCCCAGAGCCGAGCTGTCCGATCCTTGGAAGCACTCACGAGCCATCGGCCATCGGGCGAGACGGACAG
AGCCATAACGATATCAGTGTGACCCGACAGAAGATCGCAGGAAAGCGTGCTGCGGTGCAGGAGACGGATCTGTTCACTGTTCGTGGCGACAGCCAGCACG
TCGGAAGGCTCGCCGCTTGCATCAGCCTTCGGGACGTACTTGAGGTTGAGAATATCGTCATTGTAGCCGATGATCTGCGTGCGGCGGCTGAGCTTTTCGT
CAAACACCAAGAAGTTCTGCTCCGACGACACGACCACAACCTCGCGGCGCGCAGGGCTCAGCAGCAGATCCGTGTACGTCAGCGCCGAGGACGCATCCGA
CTTCTGCGTGAACAGTGTCTCGCAGGCGCTGCCACTGCTACGCCACAGGCGCAGC