Description :
From Genome Similarity Track
Location :
Scaffold_291:38154- 39444
Transcript NameFunction/comments
Phymu_g8163conserved hypothetical protein

Sequence
1290 bases(100 bases per row)
TCATGACGTTCTTGCTTCTCTTTCTCAAACTCTGCGCCATTTTCAGCACGTAGACGCGTGTTTAAAGCAGCCATGCGTTCGCTCGTACCCGTTCGTTTGT
GTGTCGTTATCAGTTCCAATTGTACGAGAGTTTGGCTTTGCTCAGCTGCATAGACAATTCCATCCATTGTGTGTTGGTCACAGGAAGGAAATCGACCGAG
AAGCAACACGCGAAGCTGCGGGTGAGAGGATACACAACGAAGTAGTGGCAAAAGACCTTCAGGAGTAAAACTATTGCCGGCCTAACGTGGAAACGTATTA
GTacgattttttttatcaGTAGAAACAGCAAGAAATGGGCGTACCAAATCAAGTCGATAGAGCCGCAGGCAACGCTGCATCATGCGCACCAGAATATGGA
TACTTCGGTCGCCAAACCCATTGCGTTGCAGGTCAAGAGCTTCAATACGTCCACTCCAGGCGATACCAGAGACCAACACGCCCACCAGTTGGTCATCCAA
CCCGCAATTTGCGAGTGAAAGAGCCGTCAGCAGCGCGTAGTTGGCCAATGTGTAGTGTAGATTGCTGCTCGTACGGGGAGTCATCACCTCTAGGCCCGTT
TCAGGGGTTAGCTGCGTCGGATTGGCGACAGTAACAGCCCTTAACCCTGTCGTTGgcactcgaagcagttcGCTCAGTGCACGAAATCCACCTTCGCCAA
TGTTATTATCCACAAGGGAGAGTGTTCGAACACTGAAATTTGTCTTTAAAGCGTGTAGAATGCGTcgaacgccttcttctggtAGTGCGTTATCTTCTAG
TCTCAAATCCACGATCGATTGGTTGCTTccgagtgctgcagcaagagaaTCCGACTCGGAAATGGTCAGTTCAATGTGCTTGAGATGGCAGTTCATCAGC
TCCAACGAAGACATCGCAATCTTCTTGATAGTCGTACAAAGCGCTTCTCTCTTAATCGCAGCCTTGTTTCTGCGTAGATAAAACTCCATTCTGGTTTGCA
ACACTGCAGCCTCCggctcgtcgtcatcctgGTTATCCTCCACGTGAACAGCAATTACCATTGTCTTCGCCTTCATTGCATCAGTTAACACCCTTAACCC
CGTAGTGGACAGCTCGTTCCTCCGTAAATCAAATTGCATATTGGGCGTCTTAACAGCTTCTAGCATCGATGCCagagctcctgctccatcgtcgtcgatc
tgGTTGTGTGCCAAGTTGAGATGACACAACGTCGTGTTGATGCCGGactgaaaaaaaatcacCCATTCTTTCAAAGCCTCACTCGTCAAC