Description :
From Genome Similarity Track
Location :
Scaffold_38:381494- 397126
Transcript NameFunction/comments
Phyra_79282Voltage-gated Ion Channel (VIC) Superfamily
Phyra_79283conserved unknown protein
Phyra_79284Asp/Glu/hydantoin racemase
Phyra_79285patatin-like phospholipase, putative
Phyra_79286cysteine dioxygenase, putative
Phyra_95365Hypothetical protein
Phyra_95368dnaJ homolog subfamily B member 6
Phyra_79289calcineurin-like phosphoesterase, putative
Phyra_95370unnamed protein product

Sequence
15632 bases(100 bases per row)
GTTTGTACCGCCGAAGATACTTGACGAAACGGCCTAGACGCAGCAAGCGTGGCAGCTTGATGTACTTGATCATCTTGAACGATTTCCTCGTTGACATACT
GGCCGCGCTGTCTTTAAGAAAGTACTCGAACGGAATGGAGGAGGCAATATCAATGGGGAACCATACAGAGCGTATGTAGGCTCGTCGTATGGAGCGCGGA
TTCATCACCACGGCGCCGTACTCGATAATCCCCGTCCGAAATCGTAACGCGATATCCAGGAACCCCCACACATCCAACACTTTCATGAATATGTAGGTGC
CCTGCGATGGCTCGTACCAGTCGAAACACAGCATAAATGGGATAATCCAGGAGTAGTAAACAACGACTAACGCACTGACGAGGTCCCAACTGGTCTTGAG
TGGAGATTGCGGATGCAGCACCCAACGATAACGCATTCGCTCGTGGAGATCGAGCAGCGACATTCGCAGTACATTTATGCTGGACTTCTCCGTCGCGAGT
CTCCGCAAACTTCCAGACGAGCGAGCCCAGGCATTGCTTCGTCGTAGTGTGCCGGGTGCACCTGGAATTGCTTGAGTAGCTGTCTTGCTTTCGTGTCTGC
TATTCCGGCCGAGAAATGTTGGGCTACTCGGGCCCGTGGCTGGTTCTTGCTGTGCAGGCGGTATCGACCGCGTTTCTTCCATTGCAGCCCCCGCTTCTAA
GCTCGTAGCAGCAGCGTCGGGATCTGTGATCACTGGCACAATATGTGAGTTGACCGACCTGCGGAACATGACGGCTGCAAATTCCCCCCGCAGCAAGAGT
CCTGCTCGGTAGATGCAAGCCGCCTGTCGATAGCAGCACGCCCAATCCAATTAAACTCACTCGTCAAGACACCAACAGAAATACCACAAGAAACAGGAAA
CCACCCAAGTTGAAGTGCTCAAAACCGGACTATTCTACAATCAAAATAACGTTAGCATCCTAAAAAACAGCACAAATCACAAAAAGCGCAGCATGTCGCT
CGGGTTTCTTACCGAATCGGCGCTCGTGCCGTCCAAGGGCAAGACCATCAATGTGGACGCCAAGAGTCTCGTGGACCTCAAGGCCCTGGTCTCCCAGAAG
GACCAAGAGCGGAAGCGTCGGCTGCAAGAGGCTCTGACGGCCGAGAACGACGACGGCAGCTCGCGACTGGGCAAATATGCGCATCTGCGAGGCGGCAACA
AGCGTCGCAAGAGCTCGGATGAGGACAAAAGGCACCGTAACCGCGGGGTGGAGGTCCGCAGACGCCGCGACGAAGAGGTCAAGCAGCAGGAAGCGCCGGA
TGAAGACGACGACGAAGCGTGGAGTCGAAAGTCGGCGGTGATGCTGCGCAAGAAGGCAAAATTGTACGAGGAAATGGTCAATGGAGGTGGCAACGACAGT
CTGAAGGGAGAGTGTCTCGTGGACTTTGAAGCAAAGAAGTTCATGACTCAGGACAGAAGCAGGAAGGCGACGAGTGTGGAGATTACGGACGAGTTCGGAC
GCTCGAGACAAGTTGCACCGGACAGCGAGGAGTACGCGGCCTTTGTGCAGACTCAACAGCAGAACGATGAAGTAAAGAGGGAGGAGGTCAGAGACCAAGA
GGATAAGGCTGGTGGGGGCAGCTTTGTCATCTCGCAGTGGGAGAAGCGGCTGAAAACCGCGGAGAAGAAGCATCTGACGGAGGTTCATGAGCGAGCGACA
CTTGCGCGGTCACTGGCGCCCGCTGCCTCTGCAGGTGCAATTGATAAGAAGTCGAGGAAGCAGCAGCGCTTGGAGCGTCTTCGCAAACAGCGAGATGGAG
CAGCGGCGAGTGGTGATGGCGGGGTAAAGAACGAAAGTACGGATGCTGCTGTGGACTCCGCAGCGTCTAAGAAGGCGACAGACTTCCTTAACCAGCTTTC
ATCATTGATCTAGTTGCAAGTAAATAATGTTGGAGCTCCGATTGATTCGTACTACGATCTAATACCTTCAGGTCTACAAGCATCATTTACGTAGCATGAG
GTTACCCTGATGATGGCGCTGCCGTTGAAGACCTTGAACTGCCAACATACTTGAGCGGTGCTAATGGACCCGTGCATGCCATGGGTGCACACAGAGGCAC
GACAGAATACACACTCGACACCTTGGCTGTGTTGCTGGTGCCTCGAGCTTTCAGCCGCGATGGGTCGGCCTCGCGAATCATGGCGCGGGCAAGCGCCACC
ATCGGGTCTATGAGGAGAACGCCAGCGAAATGTGTCTTGCCAGCAAATACGAACGGGATCTCGGTGCAACCCAGGATGATAGCCTCAGCCCCGTGTTCAC
GCACAAGCTTAGCGTAGCGCTGGAAATTGGCCTCGGAACGAGGTGACACGGCCGGCGCTGTACTCTTCACTCCCCATTCGCGGTTATATATCGATTCATG
CAGCTCTTGCTGCATCGCTCCCGCAGACACCTCGACAACCTTATAACCGCGAGGCTCGAGCAGGTCGTGATATACACGCGACTCGCGAGTACCCGTCGTA
GACATTAAACCAATGCGTTTACACAGTGGCAACTCTCTTGCAATGAACGCCACTGTCTCCTCCAGCATATGCACATGGTGCACATTGCAAGCGTGAGCCG
TGCGTCGAATGAATTCGTCCCAGATTGGTTGAGCGTGAAATGTGTTGCAGGGCACGCCCACCACGAGCCGCGCACGTCCTGCCGTAGCTGCAGCGTGCAT
CATGGCGAACGTGCGGGCCATGCCGCACGCCGGGTTCCCGACCTCCTTGGCCAACTCTTTGCTGTCACAAGGTACTTCTCCAGGAGACGACCCGCTATCC
GAGTCTGAATCGGTCGCTTCAGCGCTGGAGCTCGCAGCGTAAACCAGGTACTCGGTGCGGTCCGTCATATCTTCGGAGCGCGAGAAGTGGCAGACGTTCA
AGTGGCCTTGGTCTTCTCCAGCGCTGTCGGTGTTCTGCAGTATGAGCTGATGCAGTAGCAGCCCGGCGGCGGGTCCTACGCCACCACAGATGCCCAGCAT
CACCTCCTTGGGCCTCTTGGTCCTGACCTTCTTCACTTTGACAGCCATGGGCGACTCCATTGCCGCTGGAGGAGGGTTCACTGGCATTGAGTTGCTCGCT
AACTCAAAGGCAGCTCACTAATGGAGAATAGGTGTGACGCAGGCTCATTCCACCTCTGTCCGCGCTGCAAGACGCGTGTAGGGAAGTGCTCGAGGCCTCT
GCCACCCACTTCCAGACTCACTCGGACGAGATCGCTGATGATTGGCGGAAGCGCGTCCTCAGATCTGAGAACGCGAGCAGTGCGCCGGAATGCCGAGGGA
GAGCTGCGCTGAGTTGCTTGTTGCCACGAATTCGACTACCTTCTTTGTCGCAGCTTGTACTATTATATATAGGAGGAATGTGTCCACGATTGCGTTCATT
CTTGTCTCGAGCTGCACATTGGAATGGAACTCTCCGCTTACAGATCGCAAAAGCACCCCACTCAACAACGAAATGAACGCAGCGAACTGCGAACTGTGCG
TGGAATCACTCGGCAATGCACGTACACCGCAGCCTGCTCATTCGCGTTGATAGATTTGCGGCCACACCTACGCTTTGTGTGGCATATTCTGATCCCACCC
ACTTCAACTTGCTGCTCATCCTCGCGTAACACGGTCTAACTTCAGAATACGACATGTCAACTTCAGAAAGCGTCAAAGCGCCTCCAACGACGAAAGCGAC
CACGGCAACAAGGGGAAGAACTGTCAACTTGGCGCAGCAAGAGGCCCGAGGCAAAGCAGGACGAAGCAAATCGCAATCCGCGTGACGATATAGCATCATT
TTTCCGCCTCATTTTTTATCCACTCGCCGGGCTCAATTTCAAATACCGATCTGACATTGGTCAAAATGCCGTCGTAAACGCGCGATTGGCTGATTGACCG
TCCACCACATGTACCCATCTGTGTACGGTCCAGCTGCTGTCACCGACCCGCAGCAGCAATCTGAGAAACGAGCGTCATGTCAAGTATCGGTAAAGCATTC
ACTTTCTCATCTGCTGGCTGCAAGCCGCTTGCCATTTACTCGCCCAGAAACCAAGCAAACCGAGGTATCCACCCGCCTGCAGTGAGGAAGGCCAAATATA
CAGTACCGGCCACTACCGCTTGAGAGCCTCGACTGAAGCGTGAGGTGGAGGAGTAGTGTCCGCGTCGATTCAAATCTCTATCTCAAGCAAAATGCAGGCA
GCCGTCACACACCCGACTTCCGCGACGACGCCAGCGCCTCCGGTGCAACTGAAGCTGGAGTTACCACGCACAGCCAGCGAGCGTGCAATGCCGATGGTGC
TGCAACCCAAGGCCTCGTGGAAGGACTCGGAGCGCATTGCGCAGTTCGTGGCCAACGTGACTAGTGCAGTTCTGGTTGTGGCCATTGCCAGCTACTACCT
GATGCCGATGGCTGCGCTCGCAATGACAGAGACCCCGCGCCTAGCGGCTCAAGTGCACGCCCGTGCAGCCTGGACGGCTGGAAACGCCTCCGCGGTGCTC
ACGGACGGCTGGCAAGCGCTGCAGAAGCTCGACGTCAAACCGTCCAGTTCTTTTGTCTCGATTCTGCAGCTCGTGTTTAATAGTGCGCAGGTCACTGCAG
CGCTCACGTTGACGATTGCGTGCCTGGTGTTGATCCGCAAGTACAAGGTCATCGGCTGGTTCCTGTATCTGCAAGCGGGCGTGACGCTGCAGTGGGGGAT
CGCTTTGTACCAGTTGGCGCGCATTATATTCTCCATGTCGTGCTATGTCACAGTTAAATTTACCAAAGTCGTGCTCGTGCTTCTTCGACGTGGATATGCG
AACATCTTTGGTGTCCGCAACAGACAGGCTGTGGCGCTTCGACGACTCATGAAAACTGCGCCGACACACGCCGTGTGGGTGGAAATGGCCGAGTATCTGG
ACACTCTGGAGGGCACAGACCACTGGAAAACTACTATCTCGGACGATGACTTGGAATACTGTGACTTCGTACAGCTGCGGAAGAACTTGAGTGGTCTGAA
GCGCGCCATGGATGAAAAGAAGCCGAACATCAGAGAGCTCCGATACATGATGGCGGCCTGTGTGATGCGCAATGAGCTGGGCGTGGACTCGTCTAGCCTG
CACCTCGAATGCAAATCTGGCACCAAGACTGTGATCAACGAGTACAATGATGCTATTGTGCGCGCACTAGAGATCCTGGGAAATACGAGCGAGGAAGAGT
TTCCACGCGCGGAAAAGATCGATTTTTTCAAGCACATGAAGCAATCGTTTGGATCAACCGCGCTGTGTCTGAGTGGTGGTGGCTCCATCGCAATGTACCA
CAAGGGCATTATCAAGGCGCTTCTCGAAGCTGACGTAATGCCGAATATCGTATCCGGGTCTTCTGGCGGTGCCATCACAGCAGCAATGGTTGCCTGCAAA
ACGAACAAGGAGTTGCTTGACGATATCATACAGGACGATGTCTCCACACGATTCATTCCGCTGGGCATTCGATGGTTCCCACCTCTGCTAGATCAGATCA
CACACTGCATCAAGACGGGCTTCCTTATTGAGTGTTCTACGTTTGAGCGGACGACGCAGCATTACTACGGCGAGCCGCTGAACGATGTGCACAAGGCCAT
GTATTACACCTTCCAGGACGCCTACCTCAAGACAGGCCGTCACGTGTGTATCACTGTGTCGGCTTCCGATGTCAACAGTGCGCATAAAGGGCCCAAGAAG
CTGCTGTTAGACCACATCAACTCTCCTCACGTACTACTTTGGAGCGCAGTGGCTTGCACATGTTCGCTACCTGGAATTATGAAGAGCAAACAGCTCATGG
CACGTGACTTTGATGGTAAAGTGGTGCCGTACAATTCGCTGGGAAAAGAGTGGTGTGACGGCAGTATCCAGCACGATTTACCCATGGAGACCATGGCTAG
CTGCTTCAACGTCACGAACTTTATCGTTTCACAGGTAAACCCGCACGTTGTGCCGTTCGTGGGCGACGAGATCGATCAGCCTGGCTTCCGCAAAAGTATC
TTCCACACATTGGAAAGCGTAATTGCTGCTGATGTACGCCACCGCCTGAAGATGTTGGCTTTCCTGGGACTTTTCCCTAAGATTTACGGACACCAGTTCA
GCGCGTACTTCCGGCAGAACTTCTCCGGTAATGTGACCCTTGTGCCGGAGTTTTCGTTTCAAGAGGCGATTGGCATCAAAGCTATCCAGAACCCGACCAA
GCAAGACATGCACGACTACATTGAAGGCGGGCAGCGGACTGCATGGCCGAAGCTAGCGTACATCCGCCACCTGTGCAGCATCGAGAAGTGCCTGGACCGC
CAGCTCGAGAGTCTGCTGGGGCCGTCCGTTGTTCCTTACAACAACTGGCTGCATCCAGACTCGAAAGAGCAGACTTCGAGCGAGAGTACCCCGACGGTAT
AGCTGTACAGCTTTATGTAAGACTGACAAAAGGGAAACTATCTGTTGAAGTTTTTTATTTTAAATGGCTACATCGAACTTACCACGAGACCTGCAGCACC
GGAACGAATGCTCTCTTCTGATTGATCCAAAAAGGGTAAGTCGTTGAAGAACAAGGACACAACGAACGGTCGTTCATTCAAGCGGATACTAATGGAGACG
GCAAGCATCATGGACATGGGGACGATCGACACACCGCACACTTCCTTGGCAATGGTCCTCGATCCCGATAAGGTCGATATGGAAAGTACGAGCGCTCCAA
CTCCGATGGACCTGGCGCAGCTGGTGGAGGCTCTTGAGCGCGAGCTGGGACGCGATCCCAATCTGGCCATCAAGCACAAACCAAAACTTCAGCAACTACT
CGAGTATGGAACTTGTACTGCATGTTTTTTTCTAGTTGCAGATCTGTCCACAACAACGATATTAATACTCGACTGTACCTGTACCGGATAGGAACTTCCC
AGTGAACATGGAAGAGCTGCAGCGCTTTGCGCACTTCGATCCGTCGCGAAACTACACGCGCAACCTCATCTCGACGGACAATGAGACGTATGCTCTTATG
CTGCTCTGCTGGAACCCTGGCAAGTACAGCCCGGTCCACGACCACCCCACGGACGGCTGCTGGGTCAAGGTCATCCAGGGCTACGTGAACGAAGTGCGCT
ACGAAAAACAGGGCGACAAACTCATGGAGACGTCCAATGTGGTGCTCACGTCGGGTGTCACTTACATGGACGACTCGTTCGGACTGCACAAGGTCGGCAA
CCCACATGCGGAGAGTAACGCTATATCCATGCATCTCTACTCTCCTCCGTACGAAAAGTGTCGTGTCTGGTTCGACACGGAGGATGCCGGCAAGTCGTCC
GTGTCGGTGGCCAACTACTTTACTGAGTACGGTGAGAAGGTGGAGTACTCGTAACTTTTCTCGACGATTGTATCAAACGAGAACAGTGCGGGATGAAACA
TTTCCAATGAGATCAGCGGCCTCCCCGAAGGAAGTTTGGTTTGTAATGGTACATATACTCTAGTTTTACAATGATCTTCAGTCGTCTCTAGTTTCATTCT
CCTTTTTGTTCTTATGAGAATCCGCAGACATCGTCTCTAGGACAGCTCCGTCGGTGTTTTCGATTCGGCTTTTCCACGTGGCAATATTGTTGCGCAGTTC
TGAAATGACGGTATCGTACTCGTCGATGGCGAAAACCTGACCGGCCGTATCGAAGAGCGGTGTAGCCACCAAAGTGAGGAAGGTGACCTGACTGCGGGGC
AGGTTGGCCTGCTTTCGATCACATAGAGGCGAAATCGGCAGGTTGTTATGCTCCTCCGTCTCGCCCTGCCTGAAAAACTCCTCAGATATACGTTCGGCCC
AGCTTTGGTGGTACTCAAAAGGTTTCGCGGTGTGCCCAAGATCTGCAAGCATGAGCATCGTCTCCATGAGCAGGGATAGTTCCAGGCCCTGCGCCTCTTC
TATCATCGCAAACTTCTTGGTTTTGAGCACTGAAATACGCTGAAAGTGTCTTGCCAGGTCCGTGGCAAGAATCATCCCAATGATAATTTTGCGAGACTCA
GCTCTTTCAGGTGCAGCCATGTGACTGAAGACGTCGAACGCGTCGTGGGACAGGATACGGTACAACTCGGCAATGTGCATACGCTCCAACACCGAATCAT
CGCTGTAGGTGATTGCAAGGCTGGACTTGGTGGCGATGAGAAAGCCATTAGAAACGCCCGGGTGAGAGATATCGTGCGCTGCCGCAGCCACGAGTCCAAC
GAGTAAAGTGCCGTCGTCAACGTTCAAATGCACTCGACGTAGGTAAAAATTGATGTCAGCTACGACCGCTGCAGCGTGACTGCAGAGAATAAATAAAAAA
ACGAAGAGATCAGTTAGACCGAGTCATTCTCTCGTTTGCAAACGGGAAGCTAAAACTTACAGGTGATTGTGATATGGGTTTCGAATAGAATAGCGTTCTT
CCACTGCAGCTGCAAAATTTGTCAGCTTATTCTCGTCCAATCCAAGGCGCTCGACGAATCCATTCATGCGTACACATGCCAGAAACACTGCCTGCAACGG
TGCAGGACAGCGCTGCTTCAGGTATAGCACGTCGACGAAAAAGCAGTTTTGAAGACGATCCATCAGCCAGCTTGAAAGCTCGGCAGATGCATCCGCCCTT
ATCCCGGAGTCTATGACGTCTTCCAAATTATTGCTGCTATCAAACACGCGAGCAAGCCCACCACTAGAATAGCGGCTCTCGATATGAAGGTTCTTGGTAC
TCAGGCGTCGTGATGTTGCTACGCGAAGGATATCATTCGACAAGGAATAATGGCGAGAGCGGCGTCCGTCGCTACCGGGCCCAGCAGGAGATCTAGATTC
ATCTCCTGACGCCGCTGGATGATCTTTGAAGTCCATCATGTGCAACCAGCCCTGCACTTCCTCCTCATATTCAGGCATTGACGAGCTCACGGTCACTTCA
AAAAGATCCTGATTGCGAACGAGTGCCGTGATAATCTTGTCAATGTCGTGCTTTTCAGTGGCACTCATTTTCACCTTGATTTGGCAGAGAATTCGCAAAA
TGTCGCCCATTTCGTAGTGCAACTGATAGTTAAGTTTGCCGGATAGCTCTTCCTTCATTTCGAGATTAGCACTGCTCAATCGACGAGTCTCAGTGACAAG
GTGAAAGGATGTGAGAAACTCGCGTCGTGTACTTCGTTCCTGCTCTCGAGCGATACGAACCAAGAACAGCAACAGGAGTAAAAATGCTGCCAGAAGTGAC
AATCGTCGGCTGGGTATCACTTGCGTGGTCGAGTGTACACCAGTCGTCACGATCGCGATGAGTGCCAGCTCGGCTGCCACTACGATGCAATAGGCGAACT
GGAGGCGTAATAAACTCGTGCACACGCAAGCGCCAAGCAACTCCATAAACAGCAGGCTATCCAAAAGGCCCTCACCAAGCAGTACAGAGGTAAGCCTGAC
GTCTTCAATTTGAACTGCAGTCAGTTGCTTCGCCAAACGAGTCTGTTTCTCAATGCCCGCAAAAACTACCAGAAACAATGGGGTAACTATGCAGTGGTAA
AAAAGCAATAACACAAGCTGCACAGGATCCACCCTCACACTCGGGAAGCGGTACTCGCCTCGTCGGCGCCAAATATGAAGCACACAGACCGATGCTACTG
TGTACAACACGATTACTACGCCTACGAAAGCCTCATCATCCAGCCAGAGCGCATGAGAAAACATCGCGGTCGAAAGCAAAGACGCGTTATCTCCAGGTGA
GGCAGCTAGCTCTGCAAAAATGGACGCAACATAAGCTTCAGTAACAACGAGCGTCGCCGCGCTTGAAGAAGCGAAACACCACGCCGCAAACGCGAGCAGC
ACCGCAGCCATGTAGAAGACGATCCCGGTCTGCCATTCGCGGCGGAAGTAGGTCTGGAACTTCTGCTCTACGTCGCGGTCCTCGAAGTAGCACAAAATCG
AGTGCGTGGGCTGCTGCACCAGCACGACGGCACGCGGCACCGATCGTCTCGGCACCCCATTGACGGCGCGCTTGGAGAGGTTCGGATGCAGCAGCGGTTG
CGGCACAGGCTGTACAGGTATCAGCGGCATCACGGCGGTCATGTCTGCTCGGCTAGTACTTGGCAGCCGACGTCTGGTGACTTGCCACCCGGATCTCAAT
GCGAGCGTGCGTCTAAAGAAGCAGAAACGGTAGCTGCCATGGTCAAATGCAACAGTCGTAGAAACCACTACCAGCCTAAATGTAGCCATGCTACCAAAAA
TGGCTACATGGCCGAAATAAAAAAAGAAGGTCGTAGCACTCGCATTAGTTGGTGTAGCACACGCTACATTGGCTGGGATCAAAAAGCCAAAAGCTGACGT
GGAGCTAGTCGTCAGTTAGCAGTTACCGGTAGCGACCATGGCCGAGGCGGACTACTACGCGACGCTGGGCATCGAGAAGACGGCCACGGAGGAAGAGATC
AAGCGCGCCTACCGCAAGCTGGCCATCCGCTACCACCCAGGTCTCTTTCTCTCCCTCCTACGTTTGTTTTCAGATAGCTAACCCAGTTTGCTTCCCCCGT
AGACAAGAACTTGGACAAGAAAGAAGAAGCCGAAGTCAAATTCAAGGAGATCGGAGAGGTACCATATCTTGGGCACATCTGGTACACAACACAACTACTA
AACTAGTATATGTAGGCGTACTCGGTGCTGTCGGATGTGGACAAGCGGCGTCAATACGACCGCTTCGGCAAGGCAGGCGTGGGGGGCGCGGCGGGAGGAG
GAGGTGGCCCTGGCATGCACCCGTTCCAGGGGCAGGACGCAGAGGATATTTTTCGCACGTTCTTCGGCGGCCAGGACCCGTTCTCCATGTTCTTCCAGGA
AGGAATGCGCGGCGGAGGTGGCATGCACAACTTTGGAGGCTCTCGCGTGCATGTCTCGCAGTTCGGACCAGGGTTTTCGTTCACGTCCTTTGGGGGCGCG
CCCGGCATGGGCATGCCCGGCATGCGTATGCACCGTGTGAACCAGAGGCAGCGGTGCGTTGGCATTTGATTGCTGCAAAAACGGAGTGTGCTGATCTGTG
AATGTTGCTATTATGTGGTTGGTTGGTGCAGTGCACCGCCTGGACAGAATGTTGCTGGTGACAACAGACCTCAGGCGAACGGACGACTCTCGCAGTACCG
AATTGGCGGCGGAAACTTGTTGCTGATCTTCTTCCTGCTGTGGATCATGGGCGTGCCATTCAGCTACCTGTGGATAGCGCTTATGCTGTTCAGCTACCTT
GGCCTTGTCTAAACAGGAACTGGAGCAGTGGAGGAAATACTAAGAACCTCAAATCCCAGTAATACTGGACATCGTCTCCACGGAGCAGCACACACCTGAT
TGTGCTTCAGGTGTGCTTCACTCTCTACGGCTAGAGGCTTAGCGAGACGAACTGAGTTTCATGCGCGCTTCCTCTTCTGCAGCCAGAGCGTCGACACGGC
GCGGACGCTACGCCGCCGTCGACCAGAGCGAGCGAACCCGTATATATAATCGCTTAGTCTGAATAGATTTTGCTGCAATACGTCACACTTGTGTCCACCT
GCGTCCTCCAAACTGTCCACGTCTCAAATCACCTCGGTGAATTCGCCCATACCGCCCCTTTTCTAAACTCTCTCCAACTGTAATCATACCTCTTCACTTC
CGATCCGCCCAGAAGCGCGCCATCCGGCCGGGAATCATGACGTCGCGCGGCTCGGACGCGTCCCTGGAGCGCCGCGCCTTCCTCCCTCCTTCGCCCACAC
ACTCGGAAGATGTTCTACCTTCCCCTGACGTGCAAACGCGGCCCCGTAAGTCCTCGAATTCGCCGAGAACCAGGCCTTTGCATGGCCTTGCCGCCCTCCT
GGCGCTTGTGGGTCTCGTTATCGTCGGTTCGCTGCTCTACGCCACCGAAAAATCGTCCGGCGCCTCACTGCATGATGAGAAGATGCTGGAGATCGAAGAC
GCGTTCAACACACCGCGTCGGCTCGCGCGATTCGAGGTGAACAAGCGCATTCTGGACAATCTGGACGTTGTGAACGTCACTTTTGAATACAAGGCGCCGC
AGCCCAAGTATTTCGGACGGGATCGAGTGGCTGCGTATTGCGTGAGCTTCGCTGATGAGCTGGCCAATCGCACGCCCAGTGTGCAGGAGTTTATGGACAC
GGTGCCTACAGACGCCAAGAGCTCCGGCGTTGTGGAGATCGGACCTTTAGTCAACATGCGGTGCTCGTGGCTGCTGCGGTTCATTACGGGGGACGATCAG
GTGCTGGGAGAGACCAAGTTGCTGAGGTTTAAGCGTGGACCGACGCAGCCCTTGCAGATTCATCTCGCGTTGACGGGGAACGCGGACGAGATGAGAGTCA
AATGGGTGAGTGACAATGTCACGGATCCGGTCGTGATTTTTGGGAAAGAGAAGGAGAAACTGGAGCGGGTTGAAAGAGCGACGCAGAGCAGTTATACGAC
GGAGGACATGTGCAATGGCCCGGCGACGACCGTGTTCCCCAGGAATTATAGAGACCCGGGACAGATATTTGATACAGTCATGACCAAGCTGGAAGCAGGG
GAGACGTACTTTTACAAAGTGGGGAACCAAAAGGGGGACATGAGTGATGTACTGGAGTTTAGGATGCCTCCTGTGCCGGGCAGTAATAGTGTTGCGGCGG
ATGCAGATGGATCGAGCATGAGCTTCTTCGTGTACGGCGACCTCAACACGCCAGTTGGGGCGACGGACAACTTCGCAGAGGATAATGGCAACTGTGGAAC
GACTATGCAATTGATTCGCGAGGACATGGAGCGAGCTGCTGCTGACCCAAGTAAACACAGATATGTGGCTGTCATGCACGTTGGAGATCTTGCCTATGCG
ATGGGGTCCACGTATATCTGGGACCAATTCGGCCATCTCATTGAGTACGCTGCCGCACGCCTGCCCTACATGATCAGCATGGGTAACCACGGTATGTTAT
CGATAGCTTCCGTATGATTCATGTCATTATGGTGGAGCTAACCGGGATAATGTGTGCAACTAGACTATGGGTACTTGGAAGGTGTCAAAAGAGATCCAAC
CAAATGGCCAGTTCATCGGACATTTGAAGAGGATGGCACGCATGGCTATAACTCCTATGGCGAATGCGGTGTGCCGTCAGAGAAGCGTTTCCACATGCCC
GAGAACGGCAATGGTGTATACTGGTACAGTTTCGACACTGGTCTGGCACATCACGTGGTGGTGAGCAGCGAGCACGAGTTTGCGCGGGGTTCGCCACTGC
ACAAGTGGCTGGTGGACGATCTTAAGTCTGTTGATCGCTCAAAAACGCCGTGGCTGTTCGTATACATTCACCGACCGCTCTACTGCTCCGTCGCCTACTC
TGGTGACTATTACCGATCTCTGATGTTCCGTGATCAGCTTGAACAAGAGTTGGCTGACTACCACGTGGATATCGTGTTTGCGGGTCATTATCACTCATAC
GAGCGCACGTGTGCTGTGTTTGGTGATCGCTGTATCGAGTCTCCCAGCGGCAAGGCGATGGCGCCAGTACACATCATGGTTGGCTCAGGTGGCTACAAAG
TAGATGATGCCGGGTTCTATCGTTCACGCTGGCGCGAACAAGGTTTCCTAGAGCACGGCTACGGGCGAGTTCACATTTACAACTCGACACACCTTCGCTT
CGAGTTCGTGTCGGACGTGGAGCGCAGAGTGAAGGATGAAGCCTGGATTGTGTCGACACACGACTGGCCTAGCAAACGCGAGCGATACCCACCGGGATAC
TTCCCACCCCAAGAGATTGCAGGCTATGGCGCTGCTACGATTTTGGCTTTGCTTGCAATCTACGCCGTTATTGTGCCAGCAATACGTCGCGCAAGAGACA
AGCACTACATGCCCCTGCCGCCGATACGGTTTTCTTAATAGAGCGGAGATATCGTTTTCATATGACTCTTTCTTAGATTTTGCCATACCAGAACGGAGAA
ATCAAGAGTGAAGAAGGTGGCCTGAAGTTGAGCAGCATGTATGAAATGACGGCTGCATTGTGCCTTGATTGAGACGCTAGAGCGGGCGTCTTGTTTATTA
CTGCTGGCATACGAATCAGAGTCCAGGTGGGTAACAATGGAGACTAGCATGGATAGTTTATTGACTCTGTTTTCTTCAGTCTACAGCTCAAATTCCTCTT
CGTGTACATCGAAGTTGTGCGCACCAAGGTCGGCAATCGCATCGCCAGTAGCTGCCTTTAGCGCCTCGGGGCCCGAGATGAACACGCCGATTGTAGTATC
TGTTGAGCTGCAGCTGTGTCGTTCGTGCACTTCACGCATGATCTCAGCCATATTCGGGCGCGACCCACAGGCAACATCATACTCCTCCACTAAGTCACGA
AGCGTCCTGAGACTCATATCGTCTTCGCGATAATCTTGGTTAGCCTCTGTCGGCGATGTCGGTCGAATGCTCGAGTAGTTGCACTGTGCGACGTCATGGC
CTCGAGGCGGATTCTTGATGTTGCTGTTCGGGGCAGATCGTTGCCATCGATTCAGCAGCAGCAAGACGTACGCGACGATCGGGATCAAGAAGACGACTCC
AATCTCCACAAAGTTCTGCAAAGGCCAAAACTGCGTCTTCTTCCCGTGATCCATTAGCACGCCATTGTCAAATTCCAGCCATAGTACCAACAACGTGACT
GGCACGAGCATGGCCGAGTACAAGACGATCTTGATGCCTCTCGAACGCATTGGCTCGATAAATGGCGACGGAGAGCTACGCAGTCCTGCAAACGTTCTCG
TTCCGGCACTGTGGATGATGCTTGTCTTGCCTCGCAATCGATCGTAGTCAATTTTTGTGTCCAGCATCATTTTGCTGGGCATACGCGTCAAGTTGAATCG
AAGTGTGAACCGCTCGCCGTGTGGATCGAGGCGTTTGATCTTCGATAGTATTGGGGAAGTCTCTTCAAGCAGTGCAAGCTCACGAATGGCCAAGATGAGG
AAGATGCGTTGCAATGGAAGTGACGGATCACGCTTTTCGAGTCGAGCCACCATATCCTCTAGAATGGCAAACAGCGGCGTGGAGCCAATGCCGCCTCCAA
TCAAGCAGACCGTCGAGTATTCCTCGTATCCGGCGAGTGAAGCACCGTAGTAGCCATCCATGTACACAACTGGAAGCTTGCCATTGTCTCGGCACTCTTG
CGCGTGGTCAATGAGATTCTCAGTCCAGTCTCCTAGTGATTTCGCAAGGATGGTCAGAGATATTGCGCTCGTTCGTGGTGAAGAACTGATTGTAAACGCA
TGCCACTGCAGCTTTGAGATGGCAGGAACGTTGAGGTACACAAACTGCCCGATGTCGAAGCCGCCCTCAAGTTGGTTGGCTGACCGAGCCAGCACAATCT
TGACTAGGCCCTCGGGTAGTCGAGTAAACTCGAGCACTTGCACCGGGAAGAGCGAATTCCAGCGCGAAATCGCTCTGCTCGACAGGTAGAGCACGAGTGT
CGGAAGCAGCCACCAAACAATGATATTGAAGTGCAGCACGGCGAAGATCACCGCAGGAATGTACAAGTGATGCACGTAGTAGAACGTCTCGAAGAGATGG
CGACGAACCCACGGGTGAGACGTGAACAGGATGGCGAGCATGAAGAACAACGAGATCTCTCCGAACACGTTGAACCACTTGGGATAGCCGATGTGCCAGT
AGTCAAGCTGGCAGTCGAAGCACGGCAGCGCT