Description :
From Genome Similarity Track
Location :
Scaffold_3:38145- 39985
Transcript NameFunction/comments
Phyci_89179myosin-like protein

Sequence
1840 bases(100 bases per row)
CTCAACCACCTGCACGAGCCCGCCGTGCTCAAGAACCTGGAGCTGCGCTTCGCCAAGAAGATgccctacacgtacacgggcgccatctgcattgccgtga
acccgtaccagtggctgGACCTGTACGGCCGCGAGCTGTACCTGCAGTACCTGGAGCAGCCCCGCGACTCGCTGCCGCCGCACCCGTTCGCGCTGTCGGC
CACCGCCTACATGGACATGAAGCGCACGCAAGTGGACCAGAGCATCCTGGTGAGCGGAGAGTCGGGCGCCGGCAAGACGGAGACGGTCAAGATCATGATG
AATCACCTGGCCTCCATCTCCGGAGGCGGCAACCACGGCACGAAGGTCATCGACCAGGtgctcaagtccaacccgctgctcgagtccttcggcaacgcca
agaccaagcgcaacgacaactcgagtcgcttcggcaagttcgcccagctgcagttcgacaacctcggctcgctcgtgggctgtctgtgcgagacgtacct
gctcgagaagagccgcgtggtggggcagaccgagggcgagcgcaactaccacgtgttccaccagATCTTCTGCCTGCCGGAGGAGCGCAAGGCCGAGCTC
AAGCTGAGCGGCGACGCCACCAACTACAAGTACGTGGCGGAGGGTGCCGAGACCGAGCTCACAGGTATCGACGACGTGCAGTGTCTGAAGGAGACCCAGG
ACGCTCTGGATACCATCGGCATCTCCACGGACGAGCAGAACGCCATTTTCGAGATTGTGGCGGCCATTCTGAACCTGGGCGAGGTGGAGTTTGAGCAGAA
CGGAAACGACAGTGAAAAGTGCCACGTGAGCAACGAGGACATCGTGGACAACGTCGGCGCTTTGCTGCGCACTGAGAGCGCTGCCCTGCACTCGACGCTG
CTGGAGCGCTCGATCACGGCCGGTTCCGAGTCCTACACGATCCCGCTGAACGCCGAGCAGGCCTCGGACCTGCGCGACGCTTTGGCGAAGGGCATGTACA
CCCAGCTATTCGACTGGCTGGTGCACCGTATTAACAAGGCTATCTGCTCCACGAAGAACGTCAAGACGCAcatcggcttgctggatatcttcggtttcga
gagcttcgaccagaacggcttcgagcagctgtgcatcaactacgctaatgagaagctgcagcagaagtttaacagcgatgtcttcaaggacgtgcagcag
gagtacgtagacgaaggcatCCCTCTTACGCTCGTGACTTTCGAGGACAACCAGCCGATTCTGGATCTGATTGAAGGCCGCATGGGCATCGTCAGCATGC
TGAACGAGGAAGTCTTGCGCCCTCAGGCCACAGACAACACGTTCGTCAGCAAGGTGCTGGACGCTTGCAGCGACCACCCGAGCATCGAGAAGAACAGGAT
TAATCCGCTGGAGTTCACCATCCACCACTACGCCGGTGACGTGACGTACAACGGCACGGGATTTTTGGAAAAAAACAAGGACACGTTGCCTACCGACATG
GTGCAGCTGCTGTCTGGCAGCCAGAACGGTGTGATCTCGGGCATTTTCACCCCCACGCAGAAAAACAAGCGCAATAGCCGCGGCAAGAACGGCAAGGAGG
GCCGCCAAAAGGGTTTTCTTGTGGGTAACACTATTGCGGGCGCTTTCCGCAAGCAACTGTCGGAGCTGATGGAGACCATCAACAAGACTTCGTCACAGTA
CGTTCGTTGTATCAAGCCGAACGCCAACAAGAGCGCTGTGGAGTTCAACCGCGTCATGATTGTGGAGCAGCTTCGATGCGCCGGTGTGATTGCTGCCATT
CGCATCAGTCGTGCTGCCTTCCCCAACCGTCTGCCACTCG