Description :
From Genome Similarity Track
Location :
Scaffold_1934:3814- 6039
Transcript NameFunction/comments
Phyta_totarag13891hypothetical protein

Sequence
2225 bases(100 bases per row)
TGACCGTACTCTGTCGGAGAGAGAGAaaagcagcacctgctgcagtgtgcCATCTTGAGCAAAACACGGCGTAAATAGCGCCCAAAGTGGAGTACCAGCC
ATCAACCATGAGACCAAATGCGTCGGTCATATATCCGCCGAGATTCGTTCCCCTACCTTGACAGCAACGTGACGCATGTAGCGCAACAAGATCTTCGACG
ATACCGGCTTGATAGCAGCTAATGCACGCGCCAAGGGGTCATCCACCTCACTCAGCGCGTGGTTGCGAGTGATAAACCACTCCATCGACTTGAAAATTCC
ATCACACGCTGGTTCACAAAGCCACGAGCTTTCAGTGTCCGGCCGTTGTTCCGCTGGCTCTCTTCGAACGTCTCAGCGTAACCAGGATGATTGCTCATGC
GGTGGCTGATAAGATTCGCATTACCGATTCCTGAAACTTGCTTGCGAGCTTTGCTGCACTGGTTGCAGGAGAAGTGACCGTCGCCGCAGTCCGTGAAGAA
TAAGGTCGAGATGGCGCGGCAGGTTGACATGGCACTTGTCAAAAGTAAGAATGAGATTGGAAGCACAGTTGCAAGAAGCGTTTGCTACAGCGGTCGGGAC
CAGTCGTTTGATGCTGATCTTCGCGGGCCACCCAGCCAGGTTTCGCTTTTTTACGTGTGGTAAAAAGTCAGTATACTTATTACGGGGACAATTGGATATT
TTACGGGAATCTCGAATTTCCAATAATATGTTATTCCGTCAATATAATACTATAGTTATTATATTATATTAATTTTTTTCGAGCACTGGACAAGCCAACG
GAGAATAGGTTCACTGTCTTTTCCCAAATAGTTAGTTGCTCACGTGGTGCTTCAGCGAAATAGATAGCGGTATCGTCgagtcgacgtcgtcgtagaggca
gcagcatctcgctgctcctTAACGATAAAGCCCAGAGCAACGCCGTGTTGCTCTGTCGGTGATAGCGTGCGCAGCATTACCGCTACAGCCACCTTGCCAA
TGACTGCTGACAGTCGTTGAAGCGCCTCGCACTCTGGGTCCGACAGGGGGGCGGGGCAGTCTGCACGCgcaatgtgcgttgcagacgcagttggGCTTCT
GTACATCGGAAGGTTCTCTTGACCACGTTCGTAAGACTCCATATGAACGTGCAGTTAGTCGGTCGTTGGACGGACTAcaaagtgctaccaggtgtaatgg
gcctatacttagcccaatactttAACTTACACGTggcgcacgtgtatgaggaagcgtacGCTTCTTTGACTTGGCTTTATTATATTTGCCCCCCCCGCAA
TTATAATTAAGGCcagattaaagataataattaacactttaggtgaatttgagaactgtatttttatttgcttatttgtcagGGTTTACCTCCTAAAtgt
catactatgtaataggggtctaccgacgggtggtcggcagcACCCTATGATTTTAGTTAGTAGAAATCAGCATGTTTCTACCAATAAGATCCTTAAATGT
ATGTGGGCCAGTCATCTGCCTAAATGTACCCATTGATATGCCTCACACTAAGGAAGGAGGTTCCTTACTTCTAACAtaagccacttctgttaggtgacca
gtgatgtagccacttgtacgtgtaactCCGTTACACGAGTTCTCCATTCGCGTGGCTctcatgatgcagcagctagGAATTACACACATATATACCGCCG
ATCAGACGGGTACatacctacatgtatttagCGTCTATCTAACGCCTATCTAACGCCTACCTAACGTTCTGTCGAAAGCCGTTTTTTAGCACAGAAGACG
ATCTCCAAGCGAGACGAGCGACCTGTCTGGGTCCGCTGCAGTGGGGTATCGAAGGAACGTGTGGCTACGATGCTTCTACAGTGCCGGCACTATTTATACG
AACGGCACCTTTTTTTTAGCTATGTCCACTAAAATAACGCAAAAGCACTGTAATTTGACCAATCCATCCCAGTCGTCAAGAGACGTCGTTTGCCGGTCTT
TTCACCAAAATCTGAGCAAAATTGACGGAGCTGCAACACATAATGCCTTACGGGGGTGGCAATTGCTATACGACAGGACGGGAGGCGCAGGCTCTTCACC
ATCCTCCGAAGTGTCCGGACGCGCGTCTTCCTCAGCTGGCTGGTCTCTGTTGCTTGTAGTCGGCTGTGtatcgtcttcgtcagtcTCCGAAGGTGCCTCC
CCTGGTGCTGAATCTTCGGGGGGGG