Description :
From Genome Similarity Track
Location :
Scaffold_3:38121- 40023
Transcript NameFunction/comments
Phyci_89179myosin-like protein

Sequence
1902 bases(100 bases per row)
GACGGCGCCAACGACATGTGCACGCTCAACCACCTGCACGAGCCCGCCGTGCTCAAGAACCTGGAGCTGCGCTTCGCCAAGAAGATgccctacacgtaca
cgggcgccatctgcattgccgtgaacccgtaccagtggctgGACCTGTACGGCCGCGAGCTGTACCTGCAGTACCTGGAGCAGCCCCGCGACTCGCTGCC
GCCGCACCCGTTCGCGCTGTCGGCCACCGCCTACATGGACATGAAGCGCACGCAAGTGGACCAGAGCATCCTGGTGAGCGGAGAGTCGGGCGCCGGCAAG
ACGGAGACGGTCAAGATCATGATGAATCACCTGGCCTCCATCTCCGGAGGCGGCAACCACGGCACGAAGGTCATCGACCAGGtgctcaagtccaacccgc
tgctcgagtccttcggcaacgccaagaccaagcgcaacgacaactcgagtcgcttcggcaagttcgcccagctgcagttcgacaacctcggctcgctcgt
gggctgtctgtgcgagacgtacctgctcgagaagagccgcgtggtggggcagaccgagggcgagcgcaactaccacgtgttccaccagATCTTCTGCCTG
CCGGAGGAGCGCAAGGCCGAGCTCAAGCTGAGCGGCGACGCCACCAACTACAAGTACGTGGCGGAGGGTGCCGAGACCGAGCTCACAGGTATCGACGACG
TGCAGTGTCTGAAGGAGACCCAGGACGCTCTGGATACCATCGGCATCTCCACGGACGAGCAGAACGCCATTTTCGAGATTGTGGCGGCCATTCTGAACCT
GGGCGAGGTGGAGTTTGAGCAGAACGGAAACGACAGTGAAAAGTGCCACGTGAGCAACGAGGACATCGTGGACAACGTCGGCGCTTTGCTGCGCACTGAG
AGCGCTGCCCTGCACTCGACGCTGCTGGAGCGCTCGATCACGGCCGGTTCCGAGTCCTACACGATCCCGCTGAACGCCGAGCAGGCCTCGGACCTGCGCG
ACGCTTTGGCGAAGGGCATGTACACCCAGCTATTCGACTGGCTGGTGCACCGTATTAACAAGGCTATCTGCTCCACGAAGAACGTCAAGACGCAcatcgg
cttgctggatatcttcggtttcgagagcttcgaccagaacggcttcgagcagctgtgcatcaactacgctaatgagaagctgcagcagaagtttaacagc
gatgtcttcaaggacgtgcagcaggagtacgtagacgaaggcatCCCTCTTACGCTCGTGACTTTCGAGGACAACCAGCCGATTCTGGATCTGATTGAAG
GCCGCATGGGCATCGTCAGCATGCTGAACGAGGAAGTCTTGCGCCCTCAGGCCACAGACAACACGTTCGTCAGCAAGGTGCTGGACGCTTGCAGCGACCA
CCCGAGCATCGAGAAGAACAGGATTAATCCGCTGGAGTTCACCATCCACCACTACGCCGGTGACGTGACGTACAACGGCACGGGATTTTTGGAAAAAAAC
AAGGACACGTTGCCTACCGACATGGTGCAGCTGCTGTCTGGCAGCCAGAACGGTGTGATCTCGGGCATTTTCACCCCCACGCAGAAAAACAAGCGCAATA
GCCGCGGCAAGAACGGCAAGGAGGGCCGCCAAAAGGGTTTTCTTGTGGGTAACACTATTGCGGGCGCTTTCCGCAAGCAACTGTCGGAGCTGATGGAGAC
CATCAACAAGACTTCGTCACAGTACGTTCGTTGTATCAAGCCGAACGCCAACAAGAGCGCTGTGGAGTTCAACCGCGTCATGATTGTGGAGCAGCTTCGA
TGCGCCGGTGTGATTGCTGCCATTCGCATCAGTCGTGCTGCCTTCCCCAACCGTCTGCCACTCGTGGAGTTCCAGCAACGTTTCCAGATCATCTGCCCAT
CG