Description :
From Genome Similarity Track
Location :
Scaffold_433:3812- 5011
Sequence
1199 bases(100 bases per row)
TCTTCCACATATTCGTGTGTCAGCAATGACGAAGCTGAAAATATTTAGTGGCAAAGCCAGAGACGAAGATCGGGCTAGAAATTAAATCAGCAAGGTCAAG
TAGGAGTTCCTGCGCGATCAGGCGCCAGGCGAAGAAATATTTTGGTGTTTGGCAATCTGTTGATAGGGACAGCACGAAACTGGTACACCCAACTGATTCA
ATCTACACAGCACTAGTGGAAGCGATCGCTCGATAGTTTTATGATAAGTATGGATGGGAAGGTATAAATGTGGCCAGACAATATTATCTCCCACGGAAGC
AATCAGATGAAACCCTGCTGTAGTACCTGTATAGCCGCAATGCTGCGGCTAAGCAGGCCAAGATCGCTCTCCGAGAAGATAAATTTGCTACATCGACCAC
ACGTCCCGAACATGTGGAGCACTTCATTGCTACTCTGGACAATCACGAACTGGAAAAACAGCTGACGCTACTGCGATTGATGGATATTGATGAGATGGAG
GAAACTCTACGTGCCTGCCAGAGGATAGAGACTCGCCAGATAAAAGCGTTATTGAATTGAGCAAATTCCATCAGCGGACGACCGCGTCTTCGAATATGAT
GTCGTTAAAGACAACTCGGGGGGGGGGGGGTGCGAGATATCCTTGAGAAAGTCGAAAGCAGTAGATTGGAGTTGGAGTCATATATTGTGATAAAGGCGTA
GATCGTCGTCGCGTTTGTGCGACATTTACACCCGACTAATACAAAATTGGACAGGAATCACCGCACCTGGCAGAAGAACATTGGTTGAGGGGATGATCAC
GATCGTAGTGGACGATCGAGGGCGCGTACCCATTGTATATCTACCAGACACGACGATCGAGGATGCTGGAAGAGATTGACATAATAGAAATGTGGTCGCA
AAGTACATGCCTCTGATCAATATTTCTTTTTGTGTGCAGCCTGCGGAGAGATAGACGAGGGTGGCAAATGGCCCATGAAATAAGTTTTGAATTTGATACG
AAAATGCTAGGAGCTTACGAATTTTGCTGGAGTGTTTACGCACACGGTGAAGGAGATGTTAAACTAGGACACTAACCAAGTTGGACTCTGGCACGAGCCA
AGCGTTATAAGCTTTGTATTTATGCATTTGTTAAAGGACAACAGAAGAATCAAGAGATGAACGATTGGATCAATCCGATCGCTAATATACAAGCTATTC