Description :
From Genome Similarity Track
Location :
Scaffold_336:3812- 14884
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_336-fgenesh-gene-0.3NUC156 family protein
Pytap_DAOMBR444fgenesh-pag1_scaffold_336-abinit-gene-0.47Collagen alpha chain
Pytap_DAOMBR444maker-pag1_scaffold_336-snap-gene-0.12Conserved gene of unknown function

Sequence
11072 bases(100 bases per row)
GCAGTGTACACATGGGGCACGGGCACGCAGGGTCAGTTGGGTCACGGCCCAGTAGTCAAgTCGGGCATCCGTAGTGCCTATGAGCAACTCACGCCGAAGC
TGCTGGAGGCGTTCGAAGGAAAaGAAaTCGtGCAGCTCGAATTCGGtACCAACCACAGCGCGGCCAGTATGTGGTTCTTCTGCGACGTGGGAGATACGAG
ATGCTGTGAGTACTGATGGGGATGTGACTGGACAGTTGATGCAAAGGGGCGTGTGTACACGTGGGGATCGAATGAATACAACAAGCTGGGCCACGGCGTC
GGCTCGGGTGAGATCCAGGAGCTGCCTCGACTTGTCGAGGCGTTCGAGGGCATCAAGATCGTGGACATCTCTTGTGGCGAGTACACGACAGCAGCCGTCG
ATAGTGAGGGCAAGACCTACTCGTGGGGCTGGGGTGGTTCCACtATGAAGGGTGCAGGAGGTCTCGGCCATGCTGGTGGTCAGGACGAGGCGACGCCCCG
CCTTATCCGCACTCTAGTGGACCAAGGCGTCCcTATCGCCAAGATCGAGTGCGGTGAGTTCCACACCGTTGCACTGTCGACGGATGGCGAGATCTGGGCG
TGGGGTAATGGCGAGTACGGTCGCCTGGGCAACGGCGAGTCGCTCACGTGCGAAGTGCCGGAGCCGATCGAGTTCTTCGGTAAGGACAACGTCAAGGACA
TCGTGGCGGGCCGCGACTTCACGTTCGCACTGACTGAAGAaGGCGAGCTGTACGCGTGGGGCGTCAACAGCAGTAAGTACACaTGAGCCTTGGGGTATAG
AACGAGTGCTTAAGTAtGTGTTCTTGACTAGACAACCAGCTTGGTATTGGTGGTGGCCTCGCCATGGACTTCTACAACATGGAAGCGATTCCGACGCCTG
TCGAGTTCTTCCGTGGCAGAACGCTGACGCATTTCGCTGCCGGTCATGACCACGCTGCGGCTGTTACTGACGATGGACGCATGTACATGTGGGGCTCCAA
GCTTTGGCTCGAGCCGCATGAAATGACTGTTCTGCACGGTGAGAAGATCGTGCAGGTtGCCTGTGGCCGCCTGTATACGGTGGCTCTGTCTGAGGACGGC
AAGGTCTTCACGTtCGGTAAGGGCAGCTCCAACTGTCTGGGCCATGGCGACCGCAAGAACCAGTTGCAGCCCATGCAGGTGGCCGAGAtCGCCAACGTGC
GAGCCACATCCATCTCGGCCGgCGACCaCCACGTCGGTCTCATtAGCGAGCCACACGCCACAGCCATGGACAAGGACTTcTCCATGCGACAGTAGAGCCG
CTGCTGTCCATAGGTAGCCATACACAAAGAAAGAGAGGAAaCCGAGAAGCTGCTCCCATGTTGCCGCTCTTCCATTATGTCCGTACGGGTTACACTCTCG
TTTCAAACCTGTGTAACCTAGGTTTGAGTCAAGTCCAAGGCGGTATCTTTCTATTTTCCTCTTGTCATAAGAGACCGCGTCCTCTGAAGAGTTCATCCAG
GACACGACTGACAACCTCATGACGACCAAGAGCTGGCGGTCGGCGCTGCTCTTCACGGCACTATGCGTCGTCGCATTGCTCTCGACAGCATGCACACTGC
TCGTGCTAAGCACGGCGCTGCTGCCCACGGAAGAATGGCTCGTGGCGGCGTCTCAGGCCTCCAAGGCGCTCTGGAAGACGAACGTAATCGGGCGTCGATG
GCGAAAGGCATCGCGACGGCTATGGCGGCGTCTGGACGCGCTCCTGCATGGATCAAGTGATGGCATGGCCACGCCGCGATGGCACGGCGAGTTCACACTG
CTGGACAGCCCAAGCACGCGATATGAGAGCGATGCAGAAGACGACGACGACGTGTCGGACGACGAGTGTGAGCGCGTCGTCTCGGACTGGAAGCACGGGC
gCCTGTGCTTCATCAGCCGATAGAACAAGCGAGCCACGTGTAAATACCCATGTATACTACTGCGTCATGCTCACATCACGTCTACTGCTACTTGCCATTG
CCGTCCCGCTTGCGTTTGATGTTGTTGCGGCTCTGCATGGCCGCCGAACCTGTGCCTTCCGACGCGATCACGTCAGTGACAACGTACGGCGACGGCACGG
CGTGGTCGCTGCCCAGCAGCAGCGGGTCCAGCGACACGCTCGCGCGCACGAGCAGATTCACCTGCTTGATGACGCTGTGCGGCAGTGGACTGAGGATGAA
CAGCACGCGCCGTTGGGCGTCGATGCCGCGGATGAGCCCCACGCCGACACACGGCGCGTGCGTCTGCTGCACCTGGATGCGCGGCGGTCGCGACGGAGCA
TGAGCATCGGCTTCGACTTCAGGTACCAGTGGCGAGCGGTGCGGGTTGACACAGAGACCGACGACGCTGCAGTTGAGCGAGGCCAAGAGCTGGCTCGGTG
GAACAGCGTTGCCACAGAAGCCGACGTCAACGGCGTCGAAAGGCACCGCAAAGGGCGTTGCAGCACCGTAGGCGAGCGCGATAGCGTGACTCAGACGGTC
TTTCTCCGTGATGAAGTGCAGGTTCTGCAGCTGGGAACGAGGTAACGCAGCTGCAGACTGCGCTCCGAGGAAATACGAGTGCAGGCGGTAGAGCCGCATC
TCCTTGGACGACCGTGGCGCCTGCACGATGCTCATGGACGGGTCCCACGGCGCCACGCTGTGGATACGCCAGCGACCGGTTGTCGGGACGTCGAACTGCT
TGCTACGAGTCGTTGACAGGAGCTGCACCACGTGGTGCGGGTCTGCGTCCTGGATGACGCTGCAGAGCAGGTCGTGGCCCATGCTCTTGACCCATCCGTC
CGTGTTGATCACGAGAGGCACGATGTGTTTCATTTTCTGCCCTGCGCTAGCCGCACCCCACTTGCGCTCGTACAGCCGCAGCAGACTCTTGACCGACTTG
ACGTAGTACAATGGATCGGTGCCTGGGTTCGTGCCACCACAGAAGAACGACCGCAGCGGATTCTTCATGTGCGTGAAGCCAGGGCCGAGCAGTGGCGACG
TCAGTGCGTGTAAGGACACCATGCCAGGCGGCGTGAGCTCCGGCTGCCCGAGATCTGTATCCAAAAAGGCCACAGTGTCGTAGAAGCCGAGCAGGCGGTT
GACTACATACCGACAGAACGTCGACTTGCCCACGTCCTTGCCTCCGCATACGACAATGCgTTGGGGTACTGCATCTGCCAGCAGGCTGCGTTCGAGTGCC
TCGACGGTCGAGCTCCAGCCATGTGAGACCTGGATCGTGCGTGACGGGTCCGGCACCGCCAGTTCGCTGATCACCTGCACGGCGCTCTTGACATCATGTG
TCGCTGCTGCGCTTGGCTGGTCAGCGCCTGAGCCCGCCGTGAGCGACTGGTGCACGTCCTTGGTCACAGCAATCTTAAAGCCCGGCAGCACGACGTCTTC
CTTCTCCTTGGTTGGCACCTCGAAGTAGCACATGACGTTGCCAAACGTCAGTGGCATGGCCCGCAGTACCAGCACGACGGCGTACGACTCGCCAATCTGG
CGCGCCAAGCGGTCTACTTCGTGCTCTTCTTCCATATCGGCAAGCGCTGCCGCGTGCGGTGCCGTCTTGGCGAACAGCTGGAGGCTCGCGTCGCTGAAGC
ACCCTTGGCTCTCGGCGTCATGAACGGCcGCCTtCTTCGTGGCGCCATCGCGGAGATGCTGCTCTCTGGAGCGCGCCTCGACCACCAGTAGACTACTCCA
CTTGGGCGAGTGCACAGCGCAGTAGATCGCGAGTGGCGGCTGCCAGCCCAAGAGCTCCGCATGGCCCTGGAAAACGCGGAGGAACGCCATGCCTGCGCAA
CTCAACGACGCTCCTGGCTGCATGCCGACGGCCACGACATTGCCCGAGCGCGTGCTGAGCGCATGGTAGAGTGGTGTAGCAGGCGCAGGCGCACACGCAG
CGCCCGTGGCGTcGCCTGCGGATCGCGGACGCTTGGGTGGCATGGTGATGGCGTGTGTCCTTCAGTTCATCAGCCTCCAGTGAGCAATGACGTGGTCACT
ACACCTCTTTCTAGTATTTGCCATCTTGTTCACACCTTATTCTGATCTTTAGGTCATGTATTCACTTCTGATTGGATGTACGGGGGAAGAGAACCACCAA
TGAAATGCTGTTCATCAAGGCGTACTTTCCCACCTCATCAACAGAGGAAGCACTTCCTATATCTGTATGACACTCCATGTGCGTGAGCTGCCATGCTATT
AGCAGGCGCGCCGTGGCGTCGCGAGGCAGTTTATTTTGAGCCGCCGCTGTTGCGCTGCCCCAcAGCGCACGCGGTGCGGCGTGGCTCATTCGGTTCCCGA
CGGCTGGCAGCTGCGGCACGATGCTGCCGGCACTGAGTTCAAGGCCCAAGCAAGCCGTGCGCCAGGTGCAGGGGCTCACGGACGACTCGATCGACTCGTA
CTCGAACATGCCCATGGGGGCGTCCTCCACAGCCACGTACGCGGACAACACGACAGCGCGGTCGTCAGGAGGCAACAATACAGCGCGTGGCAAGAAGCCA
CCGGCgACGGACGAAGACGGCgCCGTATTAGCTCGCGTCGTACGCGACCGGAAGgCGTCAGGTGATGAGGAGCTATCGTTGCGAACGGGagACGTGGTCA
AGGTGCTGTCGAACAAGCGGACAGGGTACcTCAAGTGCGAGTTTAACGACGACGTGGGGTATGTGCCGTCGTCGTATCTCGAGTTCTTCGAAGAGCAATC
AGGAaGCAACGATGCGAATCCTGCTGAaGGCGAACAGCCGGATACAGCGAGGTCCGAGAGGCGCAAGAAGAAGAAGAAGAGAGAGAAGAAGGAGAAAGTT
GACGCGAGTGATGGGGAGGAAGTGGCGACGGCGCGGTCGCCACGGAAGGCGAACGGAGATCGGGATGCTATCCACGTCGCAGATGATGCAGATGCCGGTG
GTGGTGGAGATTCACCACGTAAAAAGAAGAAGAAGGAGAAAGAGAAGAAGAGCGCTCGGAAACGCGATGAGGAGGAGGGGgAAGAGAAGAAGATGGACCA
GgACGCTGCGGACGGCACGGAACGGAAGGCACGAGACAAGAAAAGCAAAAGTAAGAAGAAGAAGCGATACAGCGATAGTAGCGAGTCCAGTGAAAGCGAT
GACTACAGCGCTCGGCGACGCCGgCGACATCGCCACCGCGGTCATCGGCGCCGTGGGCGATCACGGGAACGAGACAGTGATAACGAGTCGTACAGCTCTA
CAGGCAGCTCAGACTCGTCAGCAGCTGCGCGACGTCGGCGGCGGAGACGACACCACCGCCGGAGTTCAAGTGAGGCAACCAACTCGGATGAAGAcAAGCG
TCGATCGAGTCGCCGACATCAGAAGCACCGTGGGAGTGGATCGGATGTCGACGAGAATGGCGGGAAGAGCGCGCGACGGGATCGCTCGAAGCGAGACGAC
GAGGCCAAGTCAGCGCGGAAGACAGAGCTCAACACGGAGCGAGGCGAGAGCAAGACGACAGCTCGCGACGACCGAGACAGTGCCCGGGGAAGTGTGGGTA
ACTTGGCAGCTGCAGGAGGCAGCAGCTCAGCGGTTGGTAAAGaCTCGAAGCAAAACaCGGCACGAGGAGGCAGAGACGACGAGGCTTCGAGCAAGAAGAG
CGACAACAAGGCCGCGAGTACCGGgTTGGGCAAGCAGATCGGCGAGAAAATGCGGTCTCTGCTTGGTGGTGGCAAGAAGACGGAGCGGTCGAACAAAACC
TCGAGTGGCATCCTCAATGCTTGTGCAAATACGGTGCAGGGAGAAGAGGGATGGTATGAGCATGGAGAGAATGAGCGCTACTACTTCATCTTGGTCGACG
GCAAGTGGAGCTTGTTGTACGGACCGATGACCGAAGACGACTTCGAGATCTATTGTCAAAAGGTGAGTTCTAGAGACCATGGCGTCATGGCGGATATTGA
TTGCTGACTTGGTGTGTTCTTGAGCAGGTGCTGGAGCAAAATCGGCCTGTCGAGCTGCCTCCGACGTACCTACACAAGTCAGGCTTCTACCTGAACCTCG
ACTTTCGTGTCCAGAAAACTCCGTGAGCGTAGACCATCAGAAGAGCTAGGAACCCACCcACCCACAATGCAACATATCACATGTATTCATACGAATTTCA
AAGTCGACTGCTCACCATGAGTTTCACTTATCCTTGACTCGGAGGTCCGACAACTGGAGGTGAGGCTGGTGTGGCCGCACTTGGCGGTGCCGATGCAACT
GTAGACGCCGTGGCTGAATGCGATTGGTCGATGCTGACTTCGCGCGGGAAAAAGACCTCTGGGCGGACGACTTCTCGCTGCTCTGTCACTCCCATCAGCC
ATTTGGATGGTGACCTCAGCAGCTCTTTGATATCGTCGCCGATGGAGGATTTACGAGGTCGTTCAGATCCGAACGTCTTGTCTTCCAACACGATCGCTTG
TTTCGGCCCTGAACTGCTGTCgaTCGATCCCGTCACGACCTTCCATGATGTCTGCTTGTCGTGGGGAGACAGTGGCTGAACCACCTTCTTTGACGGCGAC
AGCGATTGCCACTGGTTGTTGTCGTCGACTTCCTTCAACTCTTCGAGAATAATATCCTTTTCCTTGTTTGAATCCTCGAGATTCAGACGGAGCGTACTGG
CTTGCTTCCGTTGACCACGTCGGATCTCGTCTACTTTCTTGTCCACATATCGCTGCTGAAGCTCAGCCGGTGTAGTGCTTGCACTTACTGTCGCCATAAC
CTTGTCGATGTCAAGCTCCTCCGCACCGGCGATACCTTCCGTATGAAACTCCATTGCACTCAGTAACTCCGGTGTCCGCTCAATGCTGAACGTGCCTTGC
TTGTGCATATGGACCAACTCGGCAAGACGGGCACGATAACGTGTCCAGTGACTTGAGACAATATGATACGCGTCCCGGTCAAGAGAATGAAGGCCACGAG
GCACCTCGCACGCTTGCTCAATCGCGTGCAGCAAAGCTGGTGTCTCTTCAGCATGCAACTTACGGTTGTTGATACACTTTTCAGCATGGATGACCAAATT
ATCGAGCATTCCGCGGTTGGTTGTGTAGCGTTGTTGCAATGCTTCAAGTGCGGAGCGCTCACGTGCGCGCAGATTGACGCATTTCTCATTGATGTCACTC
AGCAGTGCTTCTGTGTCAATCATGTGCATTTTGTTGGCGTTTTCAAACAGTAGCAGCTTCTGCAACAGCACTTTGACACCAGCGCATTTGTTGCTATCAT
CGCACCACCCAAAACCACGGTGATACCACCGGTTACGCAAAGTGAACGCGGCACTGGCCCATTGCAATCGCTGCCGGTGGTACGCTCCCAGGCGCCGTTG
AATCTTCACAATCGACTCGTCCGTACCAAGAAGCCAATCTGCTACGTATTCCTTGAAGCTCATGCGGCGGCAGTTCTTTGGTACTGACAGGCTGTCACCT
GTCACTGACGGTTCGTATTGAAGAGAGTCAATTGCGCGATGCGAGATTCCATCAACTCGGTCGTGGAATCGAACAACCTCTTCGAATACCAGTGCAGCGT
AGCTGACCGCAGCGTAGAATGCCATCGCGTTTGCGTTACGGCCAAATGGGCACCGCGCGAGCATCTGCTCTGTCGGCGTTCGAATTTTCCCCTGACTTGC
TGCTTCAAGTAGCTCTTCCTTCGTGAACGCTTCTAACGGGAGGCGGTACTTTCCTCCAAGTCCGTGAAGCGCTTTTGCAATGTCCTCTTTCGTCACCACA
TCATCTCGTGACACGCGCAGCAGTGCTCGCATACATCGATCAGAAGCTGCGTACTCTGCTAGTCGCTTCATGTAGGACTCGTAAATGAGCTGCTGTTGGA
AACGCTCGATCAGCGTCATGTAATCGCCCGACATGTCGACTTCCGTGCACTCTGCGAGCTCTTCGGGTGACAAAaTAGAACTTTCCACTGGGAAGCTCTT
GATCAATGAGTTGCGCTTGCGTAGTGCTTCCATCAGGAGCATCTTACGCAGCTGCTCGATCTTGGAATCCACGAGACCCAGACCAGTATTAATTTTGGTA
GAAACACTGGTTTTGTCACGCGGTGTTGGAACCGAGGCTGGGGgCgCATTATTGCTATCTTCTCCGTTCCACATCTCGGTCCCAATTCGCATGCCCCGAA
AAAaGACCGGTTCACCcTTCTTATCCATGCCTCGCTCTTGGAGCAGTTTTTGAATCTCTCCAATCTCGTTGGGCAGTCGGACGCTACTGACCCTGTGACG
CATCATGATCTCGCGAAGATCATCAGCAGTCGCGGACGAAGGGACACTCACCCCCATCTTGGCGAATTCTTCCTTTtGCATCGTGACCAAAAGCGTTTCT
ACGAGTTCAATGACCTCGGTGGTTGGGATTTTTCGAAGATTCATCTCCTGCACAAGAGCAGTATACTCGAGTGGCACATCGAGTTCATGGTTTGTGTTGA
CTGCATGATCAATCTTCCACAGCAAGTCACTCTTTCCCAGGCTTTCAATGATTaGATACAGCTCCGCTACCCGTTCCGGATTCCAGGTCACATACGGTGG
CACCGTTGATTGCTTCCCTGAATGAATATTCTCAATTGACGCCTCAAGAAGCCGGATTTCATCGAGCAGATCCTTCGGTAGAGCTGTGACCGCTGACGAA
TGAGGTACATGAGGAGAACTCAACGCATCACACGACATCTCCTGAGGAGACGTCATCAATGGGATCACTCCTCGGTCAACAAGCGCTGCGCGCACGTTCG
CTGGAGTCAGTGCCATTTCTTCTAAAGTGATTTGTAGTCGGGTGTCTTTACCGTCCTTGAAGTATCGAAGTTGGCTGTTCTTATCTAATTCAATCCTGAT
ACGATGGCGAGGAATACGCTCCAGTTCGCGTTTTGATTCTTCGATCGCATACCATTCCGCCAAGCCTTCCAGACGATCTACATCAACAATCACTGCGGCG
AAAGCATCTGTACCCTGTGATGTTGGAGAGGTCGGTGGACGAGGAGATTGCGGATCAGACGATCTTCGATCGCTCTGTCGTGGAGATGTACTTGTCCGTG
GCGATGTTGGAGCCGCCTGGGTGCGTTTTCGTGAGGACATTGCATGCGACGCCTTGATATCACTCACTTTTTGTCTTGTTTCGATCAAGTGCATCTTCTT
TAGAATAAATGGCGTGGCCTCGCAATCGATTTTGTGATGTTCCTGCATATGGACGACATCTTCAAGCCACACCTGAACTTGTTCCCACCGCTTCTGTACG
ATCTCCAGGGTTTTGGCGTCAGTCTCGGCAAAGCCCTCGCATTGCTCATTCAAAAGCAACACCAGCTCGTTCGTGCGTCGCCAGTGGAGACCTTTCCTCT
CCGTAAGTCGGAGCTCATTCAACGGGCCATCTCTTTGTGTAATCGCCATCCAACGGAACTGGACGTTGGATACACCCTCGGCATGACGCTGGTTAAGTCC
TTTGCTGCAGAGTTGTTGTACCTTCTTTAATAGTTGAGGTGCACGTGCCATGTGGAGCTTGTTGCGTTCCTTCATTCCAACTAATTCTTCGAGGGCACCC
AAAAGATCTTTCCACTTTGCATCAACCTGTTGCCACGCTGTTTGCAAAACCAAaTCGAGTCCTTCAATCTCTGATTCAACTTTCGCAAGCAGCTCTGGTG
TCCGCTGCGCATGAATTTGCGTCGCCGCTTGAACTTGTAGAAGTTCTTCGAGTAGAGGCTGCACATTAGCCCAACGCTTGTGTACTAGTGCGACCGCCGA
CCTGTACTCATTCGCTCTCTCGGTTAGACCTTCTAGGTGTTTCTCCTCGTCAATATCGAGCTGCTTGTGCCCCGGCGTTTCTGGTGTAGCGAAGATATCC
CAGACGAGATTCAGCAAAaCTGGCGTTCGCTGCCAGTGAAGTTTGGATGTTGACTGAGCCTTCAATTCATCCAGATatCCCTTGATTGTCATCCAGCGTC
GACGCTGGGCAGGTACAACTGCGgCATTGATACGGCGGCGAGCTGTCTCGTACTGAGCGATGTATTTGTCCTTGAGAAAACGATACACATGAGTCGCTTG
CTCAAGTAAAGAACTCTCCGAGTACGTTAACTGGATCCGCAGATGTACTTTGCCATGGGTTGTCGTGCCAAAATCATGCAACACACTCGTAGGATACTGT
GAGCTTGGACTTCCAGGTCTGGTCGAAGTTGGAGCAATTCGTTTCTTTTTTTttATCAAGTCGTAGAAATTATCGTGTTCCAGTCGGTCGAGTAGATCAA
TCAGTGGGATGTATGCGATGCCAATCGCCTcGTCACCCATGTTCTGATCGTGATTCATGATAGTCACCATCAGCATGGTATGCATGATATCGCGCAATAC
CTGAGCGATTTTGATGAGCCGAATGCGTCGATATACTCGTCGGTAAACCGTTTGATCGTCTTCGTCCAAGTCTTCTACCTCCTCTTCAAAGAATGCCAAC
AACTGCTCCCCTTCATCCAAGTTGGAGGAAATTTTGTCGCCCATGGCGTCGAACTCGTAGAGACGCTGCAACGTTGGTATCAGGTGGTTGCGATATTTCT
CATACAGCTTAAGCATCGTCCGGCGAACACGAGTCGCCGCGTTATTGATATTTGGTCGCATGATAACGATCTGTTGGCCACTTCTGGGAATCATGTCACT
CTCTGTCGGGTCTGATGACCATGGCAATCGTCGCCCGGTGGTACGAACCCCAAATTCTGCCGCGGTGTCTTCAATAAACCACTTAGTTTGAGCCATGGCA
TACTTGACATGCTCCAACATACTCGTCGAAGCCAAATGACTGCTGTCATCCTTGTAAGTCAGCGTAAGTGGAGGGCTTCCTTCTCGTCTACTAGCGTAAA
TGAGCTCCATTGCGTGAGCAATGAGCATGACGTTCACGATCTTTTGCAGCTGCAACTCCTGCTCGATAGCGTCTTGCAACATTTGAGATCCCCCGTGTGG
AACGATGTTACTCGTTGCGAGCAAGCCTCGCGTAAGTTGGTTGTTGTGCTGCTTCAGTGTGAGAGCGAGAAGCTCATATTGTGAGATTAGCCACGAGTCT
TCATCCGTCTGCAGACGTCGTACCAAGACCTTGTCGCCCGGATCAATGCAATGAGATCGTTCCAGTTGAAGC