Description :
From Genome Similarity Track
Location :
Scaffold_18:38115- 40067
Transcript NameFunction/comments
Phypa_INRA-310PPTG_09370hypothetical protein

Sequence
1952 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCCTCAGTTAAGCCGAGGATCAGAACAAGAACAAGATAATGGGCAAAGGCGGCCGCCGCCGCTGGGCCTAAAAGCGG
AGGCTCGGGATCGAAGGGGGGCTCCAGCGCTCGATTGGCGAAGGTGTCAAGGCCGCAAGTGGTGGGCGACAACATTCAAGCGGCAAAGGCCGGGTAAGTC
AGCAAGCCACACGTCGAGCAAACAGGGCAGCACCAGAGCGACTAGTGCCATGCCCAAGTGGGCTTTGGACAACCGCGCGAAGGCTGCAGCTCAACCCCAA
CAACTTCCGCTACCGAGGCGAGCCGATGCAGTAAGTGTGTTACGGCAATACTCTGTCCACGTAACAACCTTTGAACGAAGTCTTTGCTGTTCTACAATGT
AGACTACATGTTAGCAGTGATTGAGTTTCTTGAAGTTGCTAGGCATGGGATGCATGTAGCCATCCGATGTGGCTTAGTCGGTCGAAGTATCCACTCAGAC
GCATCCATCTGGATTTGCCACTCGCTATTGCTGTATATTACGCCGCTTTCATTTCTCCTTTCGCCTTGAAGCGCTTAATCGATTGACCAGCATGGACTTC
CTCAACAAATTCTCTGGCGGCGATTCCAGCCACAAGGACAAGAGCAAGAAGA