Description :
From Genome Similarity Track
Location :
Scaffold_105:38111- 39645
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_105-fgenesh-gene-0.10Protein kinase

Sequence
1534 bases(100 bases per row)
ACCACCTCATGCTGGAGGATTTCCTCCGCGGAGGGACGCTGCAAGGGGTCTGGATGCATCATACTAGCGATCAGGTGCTGTAGAGAGTTGGAGTATTGGC
TGTGGAGCAAAGAACGCGTCAGAAAGTGTCCCTATGGCCGAGAGCATACGTAGACGCCATTCCACATACCGGAACAGCGTGAGGTCGCCGTCGCGGATCT
TCTGCCACTCTTCACCGCCACTCGGCAGTGTTGATCCAAGCGCAAGCTCATAAATAGTCGCCCCCAGCGCGAAGACGTCGCCTGCACGCAAGTTCGAGCG
ACTGCCTTCCATCAGCTCACTGCAATCACGAACGGTTACGTGCAGTCAGCATAACTATtGACGAGAAAGCCAGCAACAAACCACTCACCGACTTAGGTAC
CGGTTATCGCCTTCCGTGATGTCCATGCTGCCGTCTGCGAGGGCCACAGTGCCGAGGTCGCCAAGCTTGTAGATCTCTCCAGGTGCCACCAACACGTTCG
GCAACTTCACGTCCATATGCACCATTtGGCGAGCGTGCATATCTTGCAGAGCTTGTGCCAAGTGGCAAAGTaGACGGCAGAGGGTCTCTTCGGGGACATG
CAGTGGTTtATGCTGGTCGACAAATGATGCCAAGCTGCACGATCCGCAATGCTCGAGTTGGATGTACAACAAATCTTCTTCGATCCAGGCGTCGAAGTAG
CGCACGACGTGGCGACTCTCACTGAGAGCAGCCAGAGCCTGAACTTCTCGCAATGCACGCTCTCTGCAGCAAGAGGCGAATCAGCATCGCATATAGAGAG
ACAACAGTACTTGACCTACGTGTCAGCGCGACCTCGGAAGTGCCTTCGGCTCTtCTTGACGGCATACGTCCAGCCATCCAACTTCTTCGTGACCTTGTAT
ACCTTGGAGAATGCACCAGAGCCGACAAGCTATCGACAAACGTTAGTGACTTTCATACCCATAGGCTTTCACATCTGCGAGTGCCTACCTCTTGCTCCAC
AAACTCTGAAAGGTAACGAGAATATGGTACAGATACAGAGTGGCTCGCGAAAGTCGTGGGCAGCGAATGGCGGTTCTTGCGCGGGGGCCGACGCTTGCGT
GAATCAGTAGGCGGTTGAGGCGCAAAaGGGTTGGTAAACGCTTCCGCGCCGCCAACTGGAGGCGGTGCGGGTTCTGTAGCTGCACTTGGTGGTCCGAAGA
GGCTGCTAGGTGGCCTCGTAGTCCCTTCACTCTGTCGTCGTCGCCCAGGTGCCACTGCCGTGGGTAAGCCCAACACTCGCTGTGGTGTTGCTAGCAGCAT
GTCGTTCGAGTCGCTGGAGGAGAAATTAGGGAGCGTGGGTGTTGTAGTACCGAGTGGCCGTGGCCCCACGTCCATGTGTGTCATGTCTTGCGTGAGATTT
TGCACTTCCTCTTCTTGAACCATATCGACGCTGGTATGACCACGTCGCTGTCGCTTCTTCATTGGCGATGGAGTCGTCGGATGGGATAGGTGCATCACTG
GTTGGTCAGCTGGGGTACAGAAGTCCAACTCGTC