Description :
From Genome Similarity Track
Location :
Scaffold_810:3811- 4871
Sequence
1060 bases(100 bases per row)
GACGAGGAGCAGGTCGAGGAAGTCCTGGACGACGAGCCCATGCGTATTACGGGCAGAATCTTTCTCGGGTCCATTGACGCGGCACGAAACGGGGCGGCAT
TGAAGCGGTTGCGTATTGGTGGAGTGCTTGCACTGCTTGGTAAAGGGGAAGCAGAAGCTGCAGTATCGACTCAGTCGACTGCATCTATTGGATATAATGA
TGAGCTGCTGAGTAGTTCGAGGATCGCAGTGGAAATCGAGGACTCGAAGGATGTTGACTTGCTGCGGATGTTACCGGGTATTCTGGCTGAACTGGAGAAG
CTCGTGTACGAAAAGAGATAGAGATGAGCTAGAGATGGTAGTGTGGAATTGGTGGAGGTGATTTGATGAGGGGTTCTTGGAGGCTCATGCAATTGCTTTG
TGTGTGTGTGGATGATGATTGTACGGGGTAGAGCAAAAGCTGAGAGAGACGACACGAACGTGCTGGTGCATTGGTAAGCGGCTGTGCATCTGGTTCTGAA
CATCTTGTCTGGTTGACTTGCTTACTGGATGTCGTGTATTTTACGTGCTGCAGCATCGCTGGTAGATCGCGTTCTGCCTCGGTGGTCACAGCATGGATGC
TGGTGAGTGAACCTAAGAAGCAGAGTGTACAAGACGTTGTTGACCGGATCAGGTACGAATAGAGCGGGAATGTATTGTGACGATACTAGGATATGAACTG
ACAATGTACTGACAGACTCATCCGCCCATGGATTGAGATCAACCCGTCATTTTTGCAGGACCTACACCTGTTCCATGCTGTAATGCAGGTAAAGGACGGA
TCGATGATGAGAGCTAACGATGCGATGTTGTTGACGGACCGGTCATGTCCGCGACTAGACTTTGGTGCGAACCTCGTCGACATGATTCTGCGAGGCACAA
AGGCGATCACGATGCGTCTTTTGTCCGACGTTAAAGGCGATCATAACTCGGATCTGGGGGCCATCTTCTCGCACTCCGTTGTTATAGCAACGACTGCAAC
GACTGCTGGTTCACCAACAAGATTACGATTCGCCTACTTGCGAATCGATCGGATTGAAAC