Description :
From Genome Similarity Track
Location :
Scaffold_165:38106- 43460
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh_masked-pir_contig_165-abinit-gene-0.53Conserved gene of unknown function

Sequence
5354 bases(100 bases per row)
ATTCGAATTCGTGCGCTGCAGCACAAGTTCACTCTGAGTGGTGGAAGCGTCCTGCGGGACAGCATGCTGTTATCAGTCATCGCAAATTTGTTGTGCATCA
CATTAATGCAAGCTCTGAGGTTGTTTTGAGCGGCAAGAAGGCGACTCGGATAAAGGATTCGGACGCTGATGACCAACTACAGTCGATAACATTGACTATA
AGAACTTGTGCTTTTGCTGTCATGTGAATCATTGTTGCCTCATATCCTCAAATGCGGCGTAAACACGTGCAACGCAGCGAACATCGGATAGGTAGCTCCG
TCTCTCTCAGTCGATTATGTCCACCCGCCCGTCGCTCCCTCACGAGCCTGTCAAGACAGAGACGCCTAGAGATGGGAACTCGCTCCATGCTCGTGCCGAC
AAAGAGATCACTCGCGTGAACCCCAGTGAAGGGATACCTCACAGGTTGACACTCCCACGCCGCTACGCGCTTGCGGTCGATGATGATACCCTCTTCGCCA
AGTAACGCAACTTCGAGTAGTACATTAATTCGGTATCTACGTCTGTATGTTGCGTGATCTCGGTATCCCCAGACGTAGTCCGAAATGAGATCGTTCTCGT
CGATGAAATATGCGTGAAGCCGACGACTTCGATGACGATAGAAAATAGTGAAGTGGGTGTGGATCGAGCTCAAGCGTGCGCGCGATCCGCGGCCCGCTGA
TCCGGCACGATCCCCACTTAGACCTCGAGGCTCTTGAAGCGCTGCAGCTTTGAGTCGGCCACACAGCACGCCATTGGAGCGAAGCTGTGGCAGTGTCCTT
TTCTCTTTGGGATCTACAAAAGTCTTGGTGAGCGAACATCACTCGTCGGCAGCAAAAAATTTTGCTCGAAATCGTTCTTGAGTTTTTGAAACTGACTTGC
GTTTTGTATTAAAATTTGAAATTCTTTTTCCCGCGGCATGTTTGAAAATGCATACAAATGCCAAGTCACTTTCAGAACTCCGTTCTGGATGTATATTTTC
AGAAGGTGAGTGCACTGTTTCTGTGAAAGATTGCGAAAAAGCCAGATCGCATGCCAGTCAGACGTACGAGCCAGTCCATCATCCTCAGTGCTGACAATGA
CTGATTGTGGTCCTGATGATGACAGCGGGAGGTGAGGTCGTGAATGAGGAAGGAAGGAAGGAGTGAGGATGAGGATATGAAGCAGCAACAACAGCATGAG
ATGGAGACAAAGGGATTGAAAGCGAAGCGTGTGTGTATGTGAAGCAATGCCCTCTGTGTGTAGTGATCTACCGTAGCGCTTGCTTCCTGCACACAGCCAG
TTTGGAGGCGAAATAATTTGAACCCGAAGATTGATTGGAAGCCATGACACCGCCATCGTAATAAAGAATGGATCATCATATTTCGTCTTATCTTCTAATG
CGAAGGCGTTCGCTCATGCACGCGCGAGCGAGCGTCTTCAATCGGTGGGGGTCTTCTGTACGCTTCTCTCTTTTTTCTTCTTCGACTGCTTCGGCACTAC
TTCTTACTTATAACTACGGCTTGGGGATCTCGACGACAGAGAATAACTTAAATACGCCAACTTGATCATATCTCTCGAGCTCAAAAACGGACAACGATGG
ACGGCTCTGCTCTGGCTCGGCTCGCTCTGCTCTCGTGGTCATGGCGCTCGTTGGGGTCGGGTCGAGTTGGGTTGAGATCGCACGCTCATGCACTCATGAC
AGGCTGCTTCGATCCGCACTGGTTCCTTGCTTCTTTGCTCCACTCGCTTGGGGCTTGGAATGTGGACGGACGACGGGAGTCTTCGGAGACTATACTAAAA
TGGTGGGGGTGGGGGGGGTCAAAACTAGCTCTAACAGGAACGACGACGACGACGGGGGAGAAACAGACGCCACAACGCACACGCGAGGCTTCTTTTCAAA
AACTCCTTCGACTTCCTTGAGTCTCTTCAGTCATAGGAATTCCGTAATGCCTCTAGCCACAGGTGCAGCTCGTCCTGCGATCGCGCTTTCACCATTAGGG
TCTTTGTCGTCTTGCCGGCAGATGTCGTCACGGAAAACTCGCACGTCGCGCTACTGAGCTTTTCTGAATTGGTCACGTACGCGCGGCTCAGCGGCACTGC
CCACGCGTCCTCCGTGTCGTACACTGTAAACATGCTGCCCTGCAAGACGCAGTACCTCTGGCGCTTGGACTTCTTGTCGCCAACCTCCAACCACCCGCTC
TTGTCTACGATGTTGCAAAGCATATCGAGCTCCGAGTCCGAGTACGCCGCCGATACCGATGACGACGCCGTACTCGTTGTCGAGCTGTTGAGCGACTCCT
GGCGCTTCGCGAGCACTGCTGCTTCCGTGAGGCGCTCCACCCACTGCGTGCACACGGTCTCATTCTTCGCTCGAATGTCGATGATCTTGCCGCTCACCGC
AAACACCTTGAACGCGATCTTGGACTTCTTGGAGCGCTCGACGTGCGCGACGCGCACCGCCCCCGCTGGAGACGACTCGCCCTTGCACGTGAACAGCGTG
TCGCTCGTGATCGGCGCGAGCGATGAGTCTGACACGAATTGGTCTGTCGGGAACGAGTCATAGTACGTCAGCAGCGCGCCTTCGAGTACAAAGTGTTGGT
TCTTCCACTTGGAAAACCGCCCCGACTTCTTCCAGAGCCACCCGTGGAACTTCTCGCCTGACGACTTGCGCCCGTATAACATCGCCGAGCTCTGCGTCGT
CTGCACGAGCAGCTCGATGTCGACGTTCAGCGACCCGATGGCGTTTCCATGCTGGCCGCCGCCGCCACTGCCCGAGTTGTTGCGGTGGTTCATCCGCGCT
CGCCCTGTGTGATTCTGATTAACTGGCCTGGCCTCGCTCGCTCGCTCTTCTCGGGACCTGCAGTCAGTCAGTCACAGAGACAGCAAACGCGATCGATCGG
TCGGTTGTCGTTGTTGCTGAGCGGATGGATCCTCTTCCCTTCCTGTGCTTGTTCCCTGCGTGTGCGCGTGAAACGAACTTGGTCTTCCGCGCCGCTTCCT
TTCCTGCGCTCGTGCTCTTGAGCTGCTGTTGCTTGTTCACTCAGTCGATTCGATCCGATCGACTGAACGCGCGCGCTGCTTGCTGTGTATTATGCGGCGT
GTTTCTATTTCTGGTTGGCTGGCGCTCTGGCGCTCGTGCTTGTTGTTCACCTGCTTGCTTTCTTCCGACTTCAAAAAAAAAGCCTCCGGCCTCGAGCGTA
GAAGACAGCGAATGCGGGCAAGCGGTCGGTGTCGTGTAACAGCCGAGGAGGGAGCCGGTCACAAATGGCGGCCTGTTTTTGACCAACCCTATTTCGTGGG
GTTTGCATACTGGAATTGGGAACGGAAAAGTTTCGGTATAACTGAAACGAGTATTTTGGTTTTGCAGCCAATTTTGCACCAGCCTCTATCTATTGATATG
TCGCATTTTACTATTTAAAAATATACTTCAGTTCTTAATTTAGTGTAAATGCACGATATAGGAAGTCAAAATATACAAAACANNNNNNNNNNNNNNNNNN
NNNNNNNNNNCCGCGCTCTAAATTTGAATTGTGGGCACATTCTCAAGGCCATCCCCAAATAGTGAAACGAAGGTATCATTTCCCTATGAGAACAAATATT
CTTTACAAAATAATAAAACTGGCAAATGATGGTATCTGTTTTGACCAATCAGATCATGATATTTTGTTTTATGCTGGTGCTGATTTCAAACAAGAGTATG
TACAAGCTGTATTTTCAAACCATCTTTCTGTAGCCTTTAAATCGTCGAGGCTTTTAAATCCGGTTTTAACGTGTTTGATTATTTTACAAATACAACCTTA
TTTTTAAGGTGTAAACTAATATTAAACCTATTTTTTGAGGTTTTGTACATGCTTAAGCCAATCATATCACGCAAATCCTAGAGTTGTAAGAGGATTAGGT
GAAACAGTGCTACATTGACAATTTGTCGGCACATGGCGGCACATGGCGGCACGTTTGCCTCATTTGGAGGCAAATGCGCTCTATATTTGTGATCAGAAAT
TCATTTTTGTTTTCCCTTTTGCGAGTTTGAAACAAATGGAGTCAATATTGCATTCTTTCCAAGCATCGCTATTAAAACAATCCTTATTAAAGCGGGCTAT
TCCTTCTTCCTTCGGTTGAAAAAATATATATGGGAAGACTTCCTCTCGTAAATTGAACAGATACAAATAAATCTCCTGCCTTTTCGCCTATTGTCGATGG
CAGCAGCGTCAACGAAGATCAACGAAATGCGGATCGCAATGCTTCGACCTCGCGCCATCTGCTCGCATGGAACGAGGCTGGAGTTCCCACTTTGACTTGC
AATTTGTATGTCCAGCTCATCAAAAGCGAGGAGCCAGAGCAACCGAAAACATCGACCAAGCGACAAAAAGTGCACAAGTCGGCAGATTCGAGGGAGTGAT
GGTCAACCTTTTCTGTTGGAAAAGTGACTCAGCCCAGTTTTGGTCCAGATAGACCAGCCGCCTGCTGTTGTTTTTGCTGTGGCTGTTCCCCTTTATGAAC
CCAGACCAGAGCCCACCCACCGCCTCATCGCCTGGCCTTCTTCTTATCCTCCGACATTTGCAATAGAGAGTCAGCTTGCGCTCGCTTTCTCCAACAGGCA
CAATTGCAAGCCACATGGAAGCGAGTTGAGCAGCAGCAGCTATGTTAGACAAGACCCCGCAGCTGGAGGACGGAGAAGGATTACTTCCAGGCTCCCCTGT
CAGCACAGCGTAAACCAATTCATGAATATCCAGGCAGCAAGGCATCCTGGGAAGCCTCGGGAGCCTCGGACTTCCTTCCTCCGCCCACAATGGGACTCTA
TCGTCCAATCGGACGCGTCATTGCGATGGCGAGGCAACCTACTCTTTGCACGGGATGTGTAATAGGTTTAAAGCGCACGCTATAAGACATAGCATGGGCC
ACGCGTGCACAGAGCTCAAAAGGGCTCGAGAGAAGCAATCCCAATCGCTCTTTCGCGCACGCGCAATCGAATTCGCACTCGCAAACGGCCAAGCAGCGCG
CCTGTCGTCCCTTGTGGTTTGTTGTCTGGGCAGTTGGTTCAGTTGAGGACTTCGCTCTCTCTCTCTCTCTGTTTTCTCTGTTTTGAGTCCTGACATCTGA
ATCTATTGGCATCACAGTGTCACACAGAGGCTTTGAAAGCCTCGACGTCAACTTTGCAATCGCACGAACTGACTGAATTGGCACATTGCATTGTGTTGTT
CAACCACTTGCTTGCTTGTAGCAAATCTCTTTGCTGTTGATGTGTCTTCAGGAATGCGAGTGCCGTCAAGACGCGAGGCGGAAGTTAGAGCCATTTCGTT
CACAAACTGGCCAGGAAAGTCTCAAGGAAAGGAAAAAAAGCAACTCACCCACCG