Description :
From Genome Similarity Track
Location :
Scaffold_180:3810- 5150
Transcript NameFunction/comments
g6645.t1hypothetical protein

Sequence
1340 bases(100 bases per row)
ACGCGTGCTGCACACGAAATGGGTATTCAAGGCCAAACTCGATGAGGGAGGACTCCTCGAGCGCCTGAAAGCGAGACTCGTTGCCCGCGGGAATGAACAG
GAGTTCGGTGTTAACTACAGCATTACCTTCGCTGCGGTCGTCGACATGACCAGCGTCATACTGATTTTGGTGCTAATGGGGGGAGGGGTTCCTGCAAAGC
AAGGGGACGTACCGAACGCGTACGTCAAGGCCGAGAAGGAGGCAAATCTGGCCATCTTCATCCACCTCTTGCAAGGAATGGTGATCTCGGAGGAGATGCG
AAAGGCACTGGGAGTCGAAAGAGACGACGAGATCGCGCAGGAGCTGGAGAAGGCCTTGTACGGCCTGAAGCAGGCCGGGCGCCTGTGGAATAAGTTGTTA
CACAAGAAGCTGGTGACGATCGGGTTCGTGCAGTGCCTGACCGACATATTCGTGTACTTCAGATGGAGTGAGGTAGTGCTGTTGGTGGTCGGCGTCTACG
TGGACGACCTGCTCGTCACGGGCACGGAGCAACTACCAGTGGACGCCATTTTTGAGGAGCTCAGAGAGTTCTCGGTCAAGGACTTGGGACGAGCGATCAA
GTTCCTGGGGATGTGCGTCACTTACGATGAAGTGGACGGATACGAGCTGGACCAAGAGGTTACGATCATGGAGATAGTGAGGAATTTCGGCATGGAGCTA
GCACATGGCGTGCGGGCTCCCATCGGGCCGGAATGGAATGAAGCTCGAGATGCTGAAGGTGAGAAGTTGCCTGTCGCTGGAAGTGACGATGTTGTCACCG
CGAAGAAGTTTCAGTCACTGGTCGGGAGTATAATGTGGATCGCGCGTTGCACGCGGCCCGACATCGCGTTCGCCGTGCACAAGACGTCGCGGCGCACACA
CAACCCCACCATGAATGACTGGAAGCTAGCGACAAGGGTTCTGCGGTACCTCGGAGGAACGAAAGAGCTGCGGCTCCAAATGCGAGGTGACCAAAAGGCA
GATGAACTGCTGAAAGTTGCTGGGTACAGCGACGCGGATTTCGCTGCGAACAGAGAGGACCGGAAGTCCGTCACGGGCGGGCTGGTGACAGTGGACGGAA
GGCTCATTAGCTGGATGTGCAAATAGCAAGGCGGTGTGTCGCTATCGACAATAGAAGCTGAATACACTGTGGCCTCGGTAATGGCCACGGAACTTCTCGG
TGTGCGAGAGCTACTCGGTGAGCTGGGTGTCAAGCACGAACAACCCATGCTGCTGCACGTCGACAACCAGGCTGCGCTCAAGTAGTTGAACGGCGAGGGT
CCGCGAAGGCAAAGCACATCGATGTGCGGATCAAGTTTGT