Description :
From Genome Similarity Track
Location :
Scaffold_893:3810- 4881
Transcript NameFunction/comments
Phyta_totarag11215hypothetical protein PHYSODRAFT_510403

Sequence
1071 bases(100 bases per row)
GTTCCTAGGAGGCTTCAGACATCGGAaaacgcagcagcattttcacCATGCTTCCTCCCAGGTTCGCTGCCCATTTCCTTCTTTACTCTGCAGTGGCATG
TGGCTAAACGAAGGACTTGTGTTTCAACAGACTATTTTATCACGAGCACGCCGCAACATGGGTCCGGTACGATTCCACCGCGAGACACAAACGCAAGATC
TAGTAACGCGATCCTTGCAGACTCACCGTGAGTCGGGCACGCAAATGTCTCGGCGCGATCTGAAGCTGGATGAGTCATTCGACCGTCATGTGACTGCACG
ACCTTACTTCGACTCGTACCAGCTAGACAGTCTACGTGAAGACTCAgtgctgcttttgcagcgTTTGTGGCGCGGATTTCGAGCTCGCCTTTATGTGTAC
AGTATTCGCGAGCAGCGTCGCCGTGTGAATACACTCGCAGAGATCGAAGCTCAGGAGAATGAAGTCGAGGATGTCAATCGCCAGCGTCGTGAAGTCAACC
GCCGTATGCACCCGAACGCCGTAAGCGACTTCGAGGTGCTCTACAATGAGCTGGACAAGTGGCGACTAGTGGAATGTCGAAAGGTGCGCGAGCAGAGAGA
GCTGGATCCGACTGAAAGGCAACGAGCGCTTGATGCCATCCTGGCTAAGGAGACCAAGTTGCTCCAGACCATCGACCGACTCAAGTTGACGGCCACAGAC
GCAAACCGCAAGCAGCGCGTCGAAGCCATGCTGCAATTCATGGCGCGTCCTAAGCAATGGCAAATGAGTGACGGCGACGTCAAGGAGGTGCATACGCCTT
TTACTGTGCGTGCCAAGGAACTCATGGATCTGTTCCATGGGCTGCGAACGCCTCTTAGTTCAGTGGACGAGCGCTtggacatgctgctgcatatcAAGTG
GACTGTGCAAGAGTTCGACTGTGCTCTTACACGCGAGCTTGTAGAGCTCATCGATCGCGAGGCTGACATGCTGAGCCGTGGACGCAAAGAGAAAAGCCTC
GAGGGTCTGCGCAAACGTCTCACGAACCTCTTTCTGCAGTTTATCGAGACACCAGAATTCAATCCAGAGGC