Description :
From Genome Similarity Track
Location :
scaffold_1254:381- 4737
Transcript NameFunction/comments
g11220.t1 hypothetical protein PHYSODRAFT_407707

Sequence
4356 bases(100 bases per row)
GCACTTGACTGTTGCTGCTGACTTTCCTCATTCTCGGCTTTTCGTACAGGTCGCTGGACACTTTGAGGTTGTACCTCGTCGGCATCCTCGTTGTCACGCC
GGACGGAATCTCCATCGGGGCGACGTCGTTTTTTTTTCCTTACGGGGTTGGCCACGTGGCCTTGCTCCCGCCACTGCTTCGGAAGTCATCGGTGCTGCGC
TCACGGTTGCCTGTGCTCCATTAGTTCTCTGCCAATGTTCTGCTAAGCGAGGATCACCTGCAGCGCTCACGTATCTGCCTAATACCACATTAATGTCCTT
GGCCAGGTCCTTCATTGGTTCGTAGGAATCTTCGATAGCCCTAGGCCCTTCCAGCTTACCAATATCTCGAAATCCTTCGTCTTTTCGTTCCACTTGTGGT
CCTTCAACTCTTCTACAGCCAGGACAATTCCTTGCGAGGCTACATGTTCGAGTAATTCGTCCGTCACGTTTAGACTACTATCCGCATACATCTTAAGCCG
TGAGGGGTGCACATCCTGCTCTTCACCAGTTATTAAGTTCTAAACCCGAAATGAATGCGAATCGGCTCGAATAATCCGATATGGCCCAATCCAAGTCACT
TGGAGTTTGTTCCCACGCTTTTCGTCCGTTCTCGATCGCAAGACGTAGTCACCAATATGGAAATTAACCAAATTTTCACCTCTTTCCTTCTTTTTGTTTA
ACAATCTCTGCTTGAGCCGCTTGTCTTCCACAACTCCATGCATCTCTCGCAAACTGCTACGAAGTTGATCCAAATAGCCATCAATCAGCTCGCTCTGCGG
AACTTGCTGTAGATCGTTCTTCTCCGGCAAATAGAACTCTCGAAGTGGGGTAGGACACTGCAGTCCAGTGAATAATTCCACGGGAGCCCGGTTACCCAAC
GACGGCACTGCGGTGTGATTAAGATTTACCTGCACCATCGGTACCAGATACACCCAGTCTTTATATCCAATCTTGTAGGACAATATCATCGCCCTTACCA
CTTGTAGAACATCGCGGTTTACCCTTTCCACGGATCCATTTATCCATGGACTGTAGGCGAGCGTGAACGACTGTTTCGATCGGAGGCGGCGACTCAGCTC
AGCGACGATGCGATCATGCCCCAACCAAATCGGGCCATCTGTGCCTGCTCTAAGACCCCTGGATGATGACCATTTCGTTTGGCCAACTCTCGCAGAACTT
AAGGAATCCCAGGATAGACACACTTTCCCTAGTCATGCCAGCAAAGATGCAGAGGGCCTAGTGGAGATAGATGGCAAATTGTGGATCCCGTACGAAGAAG
AAGATTTACTGCAGAGACTCTGTGTCATCGCACACTGTGGTGCCCAAGGACATCGAGGACAGCAGGCTATGGCCGCTCACTTGGGCAGGATTTTCGCCAT
TGAACACCTCTCTGAGGTGGTAGAAAAATTAGTCAAACACTGCATGCTATGTCTGCATTCGAGAGGGGGGGGAGAGAGATTATCCCACGCCCGTGGAGCG
AGGTGATTGACTGCCGTACGCGTAATGGTGTTCTTCATTTTGATTTTCTTTACATGGGCGAAAGCTATGGAGAAAGCAAGTATCTTCTGGTTCTTAAGGA
CCACGCCACACATTACTGCGAGTTGGTAGTAGCAGACCCAGCTGAAAGCAGTGTTGTGGTTGAAGCCTTGTTAGCATGGCACTCACGTTTCGGTGTTCCT
CCCGAATGGGTTTCCGATTGTGGAACTCACTTTAAGAATGAGGGTCTTTAATCGCTTGGTAGACGGCATGTGGTTGCCTCCCCAACGAGAGATCATATTT
GCCCAGACGTTATCAGATCCAGGCACGTGTTCAACCACATACTGGTAGTTCATTAACTTCAAGGCCCATCGTACCAGCTTCCCTTTGACATGTTTCTTGA
TCGACGCATTCGGTGCAAATATGTGAATCAAATTTCGATGATCACAGTACATCCGAAATGGCCGTGGTCTCAGTAACAGGTAGTCGAGCTTGTCACACGC
AACAACTATGGGGAACGCTTCTTTTTCAACAACCGTCCAGTTCAACTGGCCGCCTGCAAACGTTCCACTAGTGCAGTGAATAAGCCGATGTTGTTGCTCC
GTTGCCGGTTTCCGAGAGTCAAAGTCCGCAACTTGCGTCACGATAATCGCATATCCAATGTCAGACGCATCTGTAAATAGGCACGTAGTAGCCGCATCAT
CCGGAAAATCTAGCGTAGCTGCTTTGGTGAGCGCGCCCTTGACTTGATCAAATGCTTTACGTTCCTCACTGGTAAGCTGAATCTCAATACCTGCAGCCAC
CCACTTAGTTCTCTTCGTTTTTGTGAGGGCGGTATCGAGTCTCTGCTGGAGAGGAGCTATCTGCCTTGCAAAATCAATGATACTCTGTCGCATCCAGTTC
ACTGCACATACAAATTGCTGCAGTTCTCCAGCCGTTCGTGGGTAAGGCAATGCCCGAAAAGAGTCAATTCGATTAGAGTCATGTTCGATCCCTTCCCCAC
TAATTATCCGGCCACACCACTTGACTTTGGTCTGGTACAAGGAGGTCTTCTTTGCACTTAACTTTAGTCCAAATGATCCATTAGTGACAGGAGTTCATCC
AGCTTATCCAGGTATTCCTCAATAGTTTTGGCATATAATAGTAGGTCATCGATCCAGATCAGCAAATGTTCATATAACAGGGGAGCAAAGCAGGTTTCCA
TAGTCTTCTGAAAGAAAACCGCTGCGTCACTGCAACCCTGAGGGACTCTGAGGGGAGTAAACACATTCTCGTCGGTCATGTACGATAGAATTTCTTGACA
CAAAGCCAACGGAAGTTGCCAAAATCCTTTCAAAAAGTCAAAAAGTCCGAAATGTTCCATTCCTTTTGCGTTTTCCATAACTACGGACAAAATGGGCATG
ACTGCCACCCTCACATCGGTCAATGTATTTACTTCTCGGTAATCAGTAGTCTGGCGGAGATCCATAATTTCTGCAGATTTTTTAACCGGTAGGACAGGGC
TCACCCACCGACTATTGGCGTTCTCATAGACCAGTCCTAGTTCCACCAAACGAGAGTTAAAATCGTGAAGAAACTTCCGAATGTGAGGAGGATACCGGCG
GGGCTTATATTTCGTTGGGCGAGCCCCGTCTCGTAGATGCACCTCCATCGGTGGAACGCGTGCTGGCGGGTCAGCTTGCAGTGCCAGACGCCACACGTCA
TTAGCATGGATGATCGCGCGGAGCCGCTCAACTTTGTCTTCGGGAAATCCGTTCTTCAGAGCTTGTTCCACTAGGCGTTCCACAGCTGCAAACACTTCAT
CATTTTCAGGTTTAGGATCGTCAAGTCTTACAGGAGGCTCATCAGCTTCTAAGTCAATGGGATCACCGCTGGTTTCATCTTCTCCACGGTCTGCAAGCTG
TTCTAGCTAATGCTCCACGTCAATACCCAAAGCCACCATCAAGTCGTTACCAATGATAAACTCGTCATCATTCATGTCGACAATGAACACATCCACAGCC
TTCATCGGTTCCGCCGGTCCAGCCGCAGTTCGGATCATCAAATGAAGCTTTGCCTTCTCTTCAGCGATCACCTGTGCAGCTCCAAATGTCTGGTTCCGCA
CAGGGACATCAAGTTTTTCAGCTTGTACGCTTGGGTCGAGGGACCGAAGCTGTTCCCAATGCGATCGGCCCATCACGGTATAGTCGGACCCACTGTCCGG
GCAATACGGGATCTCTAGCACTCTATTCACAGTAACCATTCGCTCAGGACTCGGCAGGAGTTCTCCAAGGCGTTTCGTCTTCGCACGCTTGACCGCGTTC
GCCTCTCGCAAGCGCTTGCGTAGCTCCATCTTTTCTTCTTTAGTGGCAGATGGACACTCATTGAGCCAATGCATTTCCTCGCATTTTGGACATGGACTTG
GAGGCAGTTTGCTCGACTTCCCCTTAGCCTTCCCATGGGTCTTCGGGGTCGCTTTACTGTCGCTACTGACCACCTTCCGTGTTGCTTCGCTCGTCTCAGT
TGCCTCCGGCTTGGTCCTGCCTTGAGGCTTCGGCTTCTTCTTCTGCGTAGCAGGTTCTCGCTGTCGTTTTCTGTTCTTCAGTCGCTGGTACTGACGCTCG
TGCTCCTTTGCCTTTTCAGTAACAAGTTCGAATAGCAGCCCTGGGGTCGTCGCCGCCTGCCTGTGAGTATACTGGAGGCACTGCTCCACCTCGTCCTTCA
ACGCTACGGGATGAAGCGAGGACACGAGCCGTTTACACTTCTCAGCATCGCCTCCGTCGCCTTCGAAACACGATGATAAACCGTTCTCTCAGACTACCTT
CCTGAATTGGTTGAAATAATCCAGTACTCGCGCCTCAACATCACTCTCCGTCATGT