Description :
From Genome Similarity Track
Location :
Scaffold_142:38095- 39564
Transcript NameFunction/comments
Hyaar_Emoy28109514-hydroxyphenylpyruvate dioxygenase

Sequence
1469 bases(100 bases per row)
AGGATAAAATGCAAGGTAATTTGATCACAGTCATTCGTCTACAAACATCTCTTGCTGCTTTAAGCCTACTGGGCTCTTGATCGCTCGTTTGCTGACGTTA
CTCACATTAATTCCTACCATTTCCTTGTTGAAGTTGTCAATCATTGTTCCGTCGACACATGAGGCATACTGACACCATTGACATCTAATGAAAGACATAC
TCAAGAACAAAGGTTTTACACTTTCTACAAGTGACTACAGGAAAACGAAGGTGAAAGGAAAGTGCGAGGAAAATGCATTAACGTAGGTTTGACACTTTCT
ACGACCCATCCACGGAAAAATATGTAAGGAACAACCTCCACAAAAAGAACATGGGGATAGTCAATTCTTCTTTATGACAAGGTACAGCCGGCCCAAGATG
ACCTAATCTCCTGAATTGCCGCCGTCCTAAATGCCGTTACAGATTACGCCGACGACTGCTCAGTCAACTTTAGGCGCCCGCCAAGTCTACCAATTAGGCC
TATTGCTCTACCAGCCAGCAACTTACAGATCCGAAATCTCTGCTGTCCCTTGCCCATTTGGCATACCTTGTATCAATGCACCGCGGAATTCTAAGGACAT
CCTTGTTCGTTTCGGATCACAAGCTCCACCGCAAATCGCAGTGTGGACCCGTCGTGCTGAGGCGTAAGCGATCTTGGTTCAAGTTAGCGCAGCTGTTCCG
TGTCGAGGTCTTCGAATATATTCTTACTGTAGTCCTCGTTACACGGCTCTTGTAGCGTGGCCAATGCTTCCTTGCTAGCCTTTCTGATGCACATGAACAC
TCACGGTGTATGACTTTGTCTCGAGATCGAAAAAAATTATGCTTTACCTACTCTGTAGCCTCACGAGCTTTGCTACTTGAATGGATCCCGTAGCTTTCGG
AACAGCTTGACCTAATCAAGGTCCCTCGAGATTCACCTCCTCGCTCGAATCCCGCACCGAATCGAGCAGACGCCGGAACAACCTAGACGCGTATCTTTGC
GAGTAGTATTCGTACAAATCGAGGCGACTCATCGCGAGGCGTTTTGAATCTTCTACAGACCCTGGCCGGACCAATCTTTAGCTTGACGTTCGTTCAAAGG
TCGCCGATGTGTGTGAAAGTCGAAAGGTCGTTCTCCTGTGGGATTAGCAGGAGATAATCAGAAGCATTCGACGCCACATTAAGGTCCATCCAGCAAGGGA
CCTTAGCTGGCCCCCCTCGGCTGGGACCTCCTCCTTCACTTGCGATTTTCCCTCGTGGTTCACTCACTATTCACACCAATTACAACCCAATAGAGATCGA
TGCCTCCAGCTGCCGACTCGAATGCCATCAAGCTCGTGGGCTTCAAGAACTTCCAGCAATACAATCCACGCACGGACCGGTTCGATGTGCACAAGTTCCA
CCACGTCGAGTTCTACTGTACGGACGCCACGAACGCGTCCCGTCGCTTCGCGTGGGGCTTGGGTATGAG