Description :
From Genome Similarity Track
Location :
Scaffold_325:3809- 5297
Sequence
1488 bases(100 bases per row)
GGCTGGGAGACGCCATCGACGTCTGTTGGTCTGCGATCGGACGACACACGCCAGCGGCCAAGTGGGGTTCCTGTGCGGACGGAATGTGCGCGTTGAAGAG
AGACAGGGGCGTGTCTCTACAAGATACAGCGTCTTGAGCAGACACATGCGCATAAAAAGTGCACTAATACGCAAATTGAGAACACTGTTGCAGAATACGC
CGCCGCATAATATGATGATTTACTCCGGACAGACCTTGGCTCAGCGCAGATTTGTGCCGTACTCGTGCGGTGGCTTTGGAGCGCGATCGTCCAGTCCCCG
TACATGATGCGGATCGAGCTCATCCACAACGCTGCACCTCACTCTGATGGTAGGGCCATCGAAGAGCACGGCATCTCTTCTCTTGGCGTCTGGCAAATCC
GCGTGGGAAAATGGGCACTCGTTTCTGGCTCGTTTGCGCCGCTCTGAGGTGCAATCCGCCACAGGCACAGAGATCCGTGGAAGGAAATCCACAGTGGCCG
CAACCGTCGAAGTGGGGCCATTCGNNNNNNNNNNGCTTCTCTTCTCTTGGCGTTTGATACATCCGGGTGGGAAAGTGGGCACTCGTTTCTGGGTCGTTTG
CGCCGCTCCGAGGTGCAATCCGCCACAGGCANNNNNNNNNNTAGGAGGCTGACAAGCTCAACCAATCGGTGATAAAACACAGGAGAAGATCTCTGGCGAA
CCACGCGTTGTGTGAAGAACAAGCCGTGACGGCATGGGTTCAGAATGGTGTCTGGATGCACACTGTGGGGGAGGCTTTCCAGCACCGGGTTGAGCATTAA
GCTAGTTTGTATATGGATCCGCCCACTAAGGTGGTCTACAAAGCCTTCCTGGCGGTCGTTTGGACCAACCGAGACCCTGTTTTCATCAAATGGCCTCCGA
CACAAAGCCAGCACACCCTGACCACTCTCGAGCCTACAGCTATCGCGTGCTCTGACGTCGGCAGCCTCCTTCGTTCCCCCATTTATCACGCCATGNNNNN
NNNNNGACGAAAAGGCACGCCGCGCGGCGCGCAGTTCTCCAGCCAGGTCCCCGTGTCGATCGCGGCCAAGGAACACGAGCGTGGTGCGTACTCGCTCACT
TCGGGGCCCCGCTCTGGTTTGTCCTCACTTTGTTTCTCCGTGTCTGCGCCAGTGCGTCCACACCCAGTGCGGACCGCAGCTGGCATTCGGTGGGAAAGGA
GGCGGACCAGCTCAACCAATCGGTGATAATAACACAGGAGAAGATCTCTAGCGAACCACGCGTTGTTTGAAGAACAAGCCGCGACGGCATGGGTTCGTAA
TGGTGTCTGGATGCCCACTGTGGGGGAGGCTTTCCAGCACAGCGTCCTTCATTCCCCCATTTATCACGCCATGTTCAAGCAAACTCACCCTTCATCTTCC
CAAAGGAAACCGAGGACACCATGATGTTCGTCCTCGTTCTCGCACCACGGCTGGTTCGCCATAATGAGTGCATCCACGGTGGTTTCTG