Description :
From Genome Similarity Track
Location :
scaffold_184:38080- 39968
Transcript NameFunction/comments
Pl_108103myosin-like protein

Sequence
1888 bases(100 bases per row)
CCCGAGGGCATCGAGGATATGACGGCGCTTAATTATCTACACGAAGCCGCTATCCTGTATAACGTCAAGAAACGCTTCCTTGTGAAGCTTCCTTATACTT
ATACAGGGGACATTTGCATTGCTGTGAACCCTTATCAATGGCTGCCGGAGCTTTATTCGGAGCAGACGCAGTCTCAGTATCTTACGAAGGCACGAGATGA
ATTACCGCCTCATGTGTACGCGACGTCTATGGCGTCATATAGTGACATGAAGCGGCATGAAGTGAACCAGTCCATTCTGGTGAGTGGAGAGTCTGGTGCT
GGTAAGACAGAGACAACCAAGATTCTCATGAATCATTTGGCTTCAGTTGCTGGTGGTCTTAATGACTATACCATTAAGAAGATTATTGAAGTGAATCCAC
TACTTGAGTCATTCGGTAATGCCAAGACAGTGAGAAACGATAACTCCAGTCGATTCGGTAAGTTCACTCAACTGCAATTCGATAATGCTGGGATTTTAGT
TGGAGCGAGATGCAGAACGTACTTGCTGGAAAAAACTCGTGTGATTTCTCATGAAGAGATGGAGCGAAACTATCACATTTTCTATCAGCTACTGTCAGCG
AGTGACAGTAAGGAGCGGTGGTTCTTAGATGACGCCAACGAGTGCTATGCATACACGGGTGCAAACAAGACTATCAAAATTGAGGGTATGTCAGATGACA
AACACTTCGAGCGCACCAAAACGGCGCTTGGACTGATCGGTGTCACTGAAGAGCAACAAGCTGTTCTCTTCGAAGTGCTTGCCGGTGTACTGCACCTAGG
ACAAATGAAAATTCAAGCGAAGAATAATAACGAAGAGTCGGGAATTGTGCCGGATGACCAAGGCGCAAATCATGCAACCAATCTTCTTGGTATTTCTGCA
GCAGATCTGGAAAAGGCTCTGTGCTCGCGCCAAATTGCCGTCGCCGGAGATAAGGTGACTACCTTTTTAAAGAAGGATCAAGCGGAGGAGTGTATCGGTG
CTTTATCGAAGGCTATTTACTCCAATGTGTTCGATTGGTTGGTAGAAATGATCAACACGTCCCTCGAAAACGATAAGAAGATGCGTCACCATGTAGGCAT
TCTCGATATCTTCGGCTTTGAGCACTTTAAACACAACTCGTTCGAGCAGTTTTGTATCAACTACGCAAACGAGAAACTTCAGCAGAAGTTCACCCAGGAT
GTCTTTAAGACCGTGCAGATTGAATACGAAGCAGAAGGTATTATTTGGAGCCACATCGACTTTGCTGATAATCAAGATGTGATTTCTGTGATCGAAGACC
GTCTCGGTATTATTTCACTGCTTAATGACGAGGTGATGCGTCCTAAGGGCAATGATGAATCACTTGTGTCCAAACTCTCCACAATTCACAAAGATGAGCA
AGACGTCATTGAGTTCCCTCGCACATCACGCACGCAGTTTACAATCAAGCACTACGCTGGATCAGTTACTTACGAATCACTGGGTTTCCTCGAAAAACAC
AAAGACGCACTTCTCCCTGATCTGTCTGACTTGATGCGAGGATCATCCAAACAGTTCCTCAGGACGATATTTACCGAAAAGATAGGCAGTCCGGTTGCCT
CACGAAAGAAAAGCAATAGCAATGCTAGAGGTGGACGACGAGCTATGGGTGGCGCCCTAACTGTCGCGAACGTTGGCACCCAATTCAAGGACAACCTCAA
CGAACTCATGACTAGTATTCGGCAAACGAAGGTACACTACGTCCGCTGCATTAAGCCGAACCAGAACAAGAGTCCAAACGAAATGGATCAACCGATGGTC
GTATCCCAACTACGTTGCGCAGGTGTGATTGAGGCAATCCGTATTTCACGTGTTGCGTATCCGAACCGACTGTTGTTGGAGGAACTGG