Description :
From Genome Similarity Track
Location :
Scaffold_86:38072- 45104
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_86-snap-gene-0.31Chromodomain-helicase-DNA-binding protein

Sequence
7032 bases(100 bases per row)
GTGAAGAGCGAGCCTGGCAAGGACAAGGGCGGCGAGTCGACCGGTCGGCGGCGCCGCAAGAAAGTCAAGTACGTGCAAGACGATGACGAGTTCTCGGACG
CGGAGGAGGCGATCGCGAGTGAGAAGAAACGCCGCGCGCGTCAGCTCGACTACCAATTGCGAGTGGTGCGGACAGTAGTTCTTTGCATTCGGTATGTTGC
AGAGAGATTGAGCTGACAATGTGGTGCAACGCACAGGACGCTGGATACCCGATGTTGGAGCAGCTTCTGGGACGGCGCATCAATAAGCGGAGTGGCATGG
CCGAGTACTTGTGCAAGTTTGTGGGCCGGTCGTACTTGCACCTGTACTGGCTCACGTTCGCCGAGCTGCAGCTGTTTGTGCCGGAGGGCTACCAGAAACA
CAACCGCGTGTGGATCTACGACCGCAAGCTGCGAAGAGAAGGGTACAACGACCTGGACGACGTGGATGATCTGGAGACGAACAAGGTGACCGTCGAGAAG
ATCCTGAACCACAAAGTCGACCCGACCGACCAGCTCGATGAGCAGATTGCCAAGCGCCGAAGCGAGGTGGAGTTTCCGATCCAGTTCCCCCATGTAACAA
ATTACTTTTTGCTAGACAACGCGGAGATGCTGCCTGAGCGGATGAATGGGATCGTGAAGAAGCTCCTGAACGAGAATGGAGGCGAGATATTTGAGAGCGC
CGTCGATCCGGACGAGGTGCCAGATTACCTCAACATCATCACGAACCCAATGGACCTTGGCGCTATCAACTCGCGACTTGCACGCGAAAACTACTACATT
GGTCCGTCGGGGCTTGCGCTGTTTGTATCGGATGTTCGGCTTGTGTTCACAAACTGCAAAGAGTTCAACGCGGAGGGCTCGGACATTTGGAATATCGCCG
ACGAACTGCACAAGACGTTTGAGAAGTGGCTATACCAGTGGATCATGTCGCCGACGGCGTGGATGAAGCTCCAACCCACTGGCGACAGTGAGCAGGATCG
CAAGCTCACGAAGGAGTTTCGAGACGAAGGCGAAGACAAGTACGATGCCTGGGCTCCGTGGCAAGTCGGCTGTAACATGTGTGGGAGCAACGAGAACAGC
AGCGATCTCTTGCTGTGTGATCGGTGCGACGGCGAGATCCACATGCACTGCTCGGCGCCGGAGATCGAAGAGTTGCCGGAGGGAGAGTGGTTCTGCCAGT
ACTGCGAGGTCCGTCAAAAGTTCGAGGATGCTGTTCAAGCTTTCACCAGCGAGAGTGCGCAGGAGAAGTCGGACAAAGCGCAAGCCAGCACTGCAAAGAC
GAAGACTACCGCAATTCCCAACATCCTGTCTGCGGCTGTCGACGGCGACCGTAAGTTCAATATCCGCGTCCAGTCCAAGTCCTCGTCGGGCGAAAGCGAT
CCGGCCAAGAAGGAAAAGACAGAGATATCGCCAACCAACAGCCGCGCGACTTTCTTTCTGGTCAAGTGGGTCGGAATGTCGATTCGGTACTCGACTTGGG
AGAAGCCGGAAGATATCGGCGACGACGAGCAAATACAGCGCTACTTCAAGTTCAGCCGTATCCCGCCTCAGAAGGAGATCCTCGAGACGACGTGTCAGCT
GCCGTGCTGCGCCAAGCGAAACCAGTACACCATGTCGGGGGCTGCGCGCCGCTGCGGGAAGGATCCGTTCTGCACATTGGGCAGTCAGCACGAAGGCGAA
TGCAGTCGAGATTTGCAAGGCATGAACACGCCTTACGGCAGCAAGGACTATCGCAAGCTGCGCATGATGGAGCAGATCAAGGCGCAGCTGTTCGCCTTCC
ACTGTTTGTTGAACAACCACACACCTGACAAGGATGTTCTGAAGCAGTGCGGCGTGTTCGCGAACGCGTACGTTTGCAAAAAGCAGTACTTGGCCACGGC
GGTGAAAAAGAACGAAGACGACGATGAGGATTACTCGGAAGACGAAAACGCCGAGTCGTCCGAAGAGGAAGAGTACGACGACGACGAAGAGGAGATGATG
TTTCGACGACCGACTCCGATCTACCCTGGCATCGTCGAGCCTGAGTCGGCGGACGATGGAGATGATGACGAGTCTGCTTTAACGAGGAAACCCGAGATCG
AGGTGAGCGAGGTGCTGAGTTCGATCGTTGAGCATGTGGTGCTTGGCTACCCGACGACGCTGAGCGAGGTGGACAGCTCGGTGCAATTCAACTCGCGGTA
TCCGCCGACGACGTTCCGCTCGCTCCCGACGTTCACCGAATACTACGTCGCATTGATGCGGTCTCCGTTCGGTCTCGGCATGCGCTTGGGTGTTTCTACC
GACGAAAGCACTTGCGTTCTCGGGTTCCAGCCGCTTGCGAATGGCATGATGGGTCCCGCGCAGGCGTCGCAGGTGATCTCGATCAGCGACGTTCTCGTGG
CAGTGAACGGCGTCAACGTCGCCAGCATGCCGTTCAAGCACGTGGTTCAAGTGATCAGTCAGGCGCCAGCGCAGGTGCTCTTCTGCTTCCATTCACGACG
CATGGCAAACACATACCCACATTACTGCCAAGCCAAGCAAGTCACTCTTGAGCGCCGTGAAATCTTGCCTGACCACACACTTCCGTCGTCTGAGTATGTG
CCTTACAGCTTCGAGAAGTATCGCCCGATGCTTCAAGTTGGCCGCCACAACGAGTTGACTGGCGCTACGCCTCGCCACAGTGTGGATCACTCTAGCTACA
TCGTTCCCAGTGGACCGATGCAGCATCTGTACACGGGAATCGTCGACAACAGCATCGACCCGCACGAACACTTTGCCAGTTTCTTGCCTGAAGGCGCTCG
GAAGGCCACCAGCAAAAAGGACGACACGAAGGATGATGCAAACGAGTTTATCCCGTACGAGCAGTCGCCAACCTACAAGGGCGGGCGAACGCTGCGCGAG
TACCAAGTCGAGGGGTTGAACTGGATGGTCTCGTGCTTCAAGGCGCAGCGATCGTGCATTTTGGCGGACGAGATGGGTCTCGGCAAGACTGTGCAGGTCG
TGTCCTTTATCGAGCACCTCAAGACAGAGGAGTCGATTCGAGGACCGTACTTGATTGTTGTGCCGCTGTCTACCATCCAGCACTGGCGGCGTGAAATCGA
GAGTTGGACAGACTTGAACGTGTGCGTGTACCACGACATTGGTGACCGCACGACCAAGTTCACTGCCAAGGATATGCGCGCTGTGATCCGCGACCAGGAG
TGGTACTACCCCGGTCTCGGGAACTCGTCGGTGTTCAAGTTCCACATTTTGCTGACCACGTTCGAGACTGTTCTGTCGGACTTTGAGGAGCTGGAGCACA
TCCACTGGCGCTTGATCGTTGTCGATGAGGCTCACCGCTTGAAGAGCACCGGATCGCGAGTGCTGAAGCAGATGCGCGTGCTTCATTGCGACCGCAAGTT
GCTGCTGACGGGAACTCCTCTGCAGAACAACACCCAAGAGCTTTGGGCACTGCTGAACTACCTCGAGCCGGTCAAGTTCGACGACGCGGACGATTTCAAC
TCCAAGTTTGGCAAGCTGCAGTCGCAGGCTCAGGTTGAGCAACTGCAGAAACTGCTGGGGCCGTACATTTTGCGTCGCGTCAAGGAAGACGTCGAGAAGA
GCATTCCGCCAAAGGAGGAGACGATTATCTCAGTGGAGCTCACGACTCTCCAGAAGCAGTACTACCGTGCGATCTATGACAAGAACAAGAGTTTCCTGTA
TCGCGGCACGAAGAACGGACTTCCGACTCTCAATAACATCCAGCTGCAGCTGCGCAAGTGCTGCAACCACCCGTTCCTGATCAAGGGTGTTGAGGATCGC
GAGTTGGAGGAGCTGGGTCCGCGGCCTGCTCCTGGAGAGGTCATGGAGAAGACGATCCAGTGTTCTGGCAAGATGGTGCTGGTGTCCAAACTGATCCCGA
AACTCAAGCGCGAGGGCCACAAAATCCTCATCTTCAGCCAGTTTCTGAAACAGCTCGACCTGATCGAGCGCTATTGCGACATCAACGGCTTTGGCTATGA
GCGGTTGGACGGGTCGACGGGTGGCAGCGTTCGTCAGAACGCGATCGATCGATTTTCTCGCCCGCATGCCAAGTCGTTCATCTTCTTGCTGAGTACGAAA
GCGGGTGGTGTGGGGATCAACTTGATTGCGGCAGACACGGTCATCATCTTCGACAGCGACTGGAACCCTCAGAACGACTTGCAGGCGCAGTCACGATGTC
ATCGTATTGGTCAGAAGAAGTCGGTCCAAATCTATCGACTTGTCACGAGGAACACATACGAAAGCCAAATGTTCGACCGTGCCTCCCGGAAGCTTGGTCT
CGAGCACGCCATCCTGGGCACAGCGTCGTTCAGCGAGACGACCCAGATCGAAAAGCCGAGTGCCGAGCAGCTGGTCGAGCTGCTGAAGCGTGGAGCGTAT
GCGCTGATGGAAGAAGATGACACGGCGTCCAAAGAGTTCGCCGATCGTGATATTGAGACGATCCTGAAGGAAAACGCTCACGTGCGTGTGGTTGCTGCGA
CCAACAAGGACGAGGAGACGGATGACACGGACGAGGAGGTGACGCCGAACTATCTTCAGCGCAAGTCGCCGAACAAGCGCGTTCGCAAATCGCTTGGAGG
CATGGCAGTCGACCGCTCGTCGTTCGTTGCCGAAGGGTCAACGGGTGAGCTGGCAGTTGACGACCCTAACTTCTGGGAGAAAGTTCTACCTGGCGCAGTG
TCGGTCGAGATGCTGAGCTTGAAGCTGGAAGACGGCAGTGCCGTGAGTTCGCGGCAATCCAAGATCAAGTTTATCAGCAATTTAGAGATCGCGCTGGATA
ATTTGGTCGCGGATTTGCAGGAAGCCAACGACGAGGACAATCCGAGGTTTTCGTCCAACTTGACACACGAGTACGACATTGCGATCCAGGTCGTGCATGC
GGTGAGCGGGAAGTACCGCGGCGAGTTTTCCACTGAGCAGCTCGATTTGGTCAAGAAGTGTCTGGCGAAACTCGAGAAGTCGCGTGTTCGCCGCGGACGC
TACCAGCGCAAAGATACACAAGGAGAGATGAACGGATCTGGTGGCCGCGGTAACAAAAGGAAGCGTCAGTCGACCGGTGGGTACGCCAGTGAAGACGATG
TTAGTAGCCCTGAAGAGGACTACGAGGACGCGACGCCGGTGAAGAAGAAGAAGACGGGTGGCAAGCGAGGGCGACCGCGGAAGCATCCGTTGCCCTCGAG
TCCTCCTCGCAGCCACAAGAAGAAGGCTCCAACGGCAAACGGGTTCACTTCATCCCCGCTGCTGTTCCAGAACGGCGCGATCAACGACAGCGACGACTTG
TGCACATTGTGCGGAGACGGCGGGCTGATCCTCTTGTGTGACGGACCGTGTCATCGCTCGTTCCATCTCGAATGCGTGGGCATGGACACGGAACCCGACG
AGGAGAAATGGCTTTGTCCTGACTGCACCGCCGGCCGCCACATGTGCCTGATCTGCAAGCAAGTGGGCGAGATGGGTACCGAGTTCGGCGTGCTCCAGTG
TTCGATGGCCAAGTGCGGTCGTTTCTACCACAAGGGGTGTCTGGTCAAGGACTCGCATGTGGAGTGGGTCGGCAAGAAGCGCTTCCGATGTCCGAGCCAC
TTTTGCCATGGTTGTGGTCGCGCAAGCGTCGAGACGTCCGCGAGTCACATCAAGAAGGCCAAGAAGAAGCGGCCAGTCATTAAGGACGATGACATCGTTG
TGAGCTGCATCCACTGCTCGCAGGCGTTCCACCCTCCATGCGTCAAGGCTGCAGACAAGTATATGCGTCTCTCGAAGCGGCTGATGATCTGCACGAGCCA
TTTGGACAGCAAGACTGCTAAGCCGGTAGCCACGTTGGCGACCGGAGCGCGCCACTCCAGCGGCCACCCTGCCGCCAACAGCGATGAGGTCGGCGAGGAG
GCCCCGATGCCGATCCCTCTGGATGGTGATGAGTCGGCAGAGGAAGCACCGCGAAGCGCCAAGAAGAAATCCAAGTCGAAGCGGGCAGCTCCAGTGGTGG
AGGAGCCACCGGCTGAGGTGGACCGGATCTGTGCGCTGTGTCATCGTGGAAAGCCTAGTGCTTCGACGCAGACGGAGGAGGATGAGACGAAGGACTCGCG
GAAGCGCAGCCACAAGCGGTCGGCGGCAGGATCGGACGACGTGCCTTCGAGTTCCGAGTCGGATGCCAACGCGGGACTCGAAGGCCCTTTCATCGACGCT
CCCGTGCGGCTCCACTATGGCGACAAGACGGAGGAGGTGTTTGTGCACTTGAACTGCGCGCTGCATTCGCCCGAGGTGTACGTCAAGCCCGACGGACTCA
TTATGAACCTCGACAAGACGGTCAAGCGCGGGCGGCAGCTGCGGTGCACAGCATGCAAAGTGACGGGAGCGACAGTCGGCTGCGTCGTCGACAAGTGCAA
GTGCAATTACCACCTGCGATGCGCGCTCGAGACCGGCGGCGAGTTCGTCGAGGCGACCTACAGCCTGTACTGCAAGGAGCACGCCGAGGCCAAGCGGCTG
GCGGAGGCGTCGTGCGGCGTGTGCGGTCGTGGCGACGGCGAGGCGCTGTCGGACGATGAGAGGCCGTCGGCGGCGTCGATCGCGCTGTCGCTCACGTGCG
GGACGTGCAAGTCCAAGTTCCACCCCAAGTGCGTGCACATGTCGGACCGCCAGGCGGGGCGGAAGGCGAAGGACCCGAACTGGAAGTGTCCCGACTGCGC
CAACCACGCCCACAAGGACGCAGCGGTATGTGCGAGTCGTGATGTATTGAGCAATGGAGTTGGTTGTGTATCTAACGCGTTGGTGTTTGTGGAGCAGGCG
CCGGCGAGCAAGAAGGCGAAGACGGCGGCCACGAGCTCGACCGAGGCGGCGACCAAGGCGGGAGGCAACAGCTCCAGGTCATCCCGGAGAAGTGCACCGG
CATCCAGTCGCGCCGAGTCGTCGCCTCCGAAGAAGACGGCGGCCAAGAAGCGCAGCGCGCGCAAGACCAAGGCGAGCGGCAGCGACATCTCGCCGCACAT
GGCGGACAGCGACATCTCCGAGGACGAGTGAG