Description :
From Genome Similarity Track
Location :
Scaffold_1815:3807- 5053
Transcript NameFunction/comments
Phypl_g14199hypothetical protein PHYSODRAFT_339182

Sequence
1246 bases(100 bases per row)
AGGGCGGCTCGGGCAGTGGGCTGCACTCCTGTCTCCCTGGACTTTAGAGATCACGAAGTGCACCAAGGGCGAGGATGAGATCTTTGGGGCACTAGCAGCG
AGCGTCACCCCTCGATCAGTGGTAGACTAGGCACTAATAGCGATTGCGCCTCGGAAGGAACCCCGGCGAGCCATTGAAGTGTCGGTTCCCACAGTACAAC
CAGATGAAAGTCTCCTGGTGGTCAGTTTCGATGGATCCGCGGGTCAAGCGCAGCGGAGGCGCGTTTATCGCGATTGTGTGGAAGATACCTGAGTGGACAG
TGATCGAAGCTGCATCGGTGTACAAAACAGACCTGACGGTGAACGAGGCGGAATATGGAGGACTACTGTTATGTTTTGACTTGCTGCGTGAACTAGATCC
GTACCGGCTAATTATTTGTGGCGACTCCAATCTGGCCATTCGACAGATGAAAGGTGAGATAGACTGCAAAGCCCCCGCTCTGACACTGCTTCGTCAGAAG
GCACTACGCCGACTCCAAGAATGGCCACGCCATGACTTGCTGCACGTGAAGCGAGCCTGGAACGCGAGCGCCAACAgtccagcgagcgcggccttACAAA
GGGAGAGTGGCAGATGGATCGAAGACAGATCGGATACCGAAACCTTCATCACACTGAATCGACTGGGTGAGATCCTGATCCCGGTAGCGGAAGGAAGGAC
CGTCCGAGTTAGTACTGCGATGACAAGGGCTCGAACGAAAGCTCAACGTCCCAAGGCCTTGGAAAAGGAAGCAGTGAAACAACTCAGGGTGGACCGGATc
cgccaagctcaagacgaagaagcatGGGTGGTGAACCTGAAGTCGTATATACGAGGAGAGGTACACAATCTGACCCAAGCGGAGGCCAAAGTGTGTAGTC
TGCAAAGAGCGGATTTTGAGCTACACGTTAACGATCTCCTGTTTTACTGCCCACCATCCGCGAAAACGGAGACGGATCTGGATGGTTTGCTACGACTGGT
AGTCCCCGAAGGGCTACAGGCGTATATACTGCATCACTATCATGTGAGCCTGGAGGGCGGTCATCAAGGGATCACCCGTACGTTCCAACGGATCCGAGAT
CACTTCTATTGGAGAGGACTTTTCCGATCGGTACAAAAGTTCGTGGGAGAATGTGGAGACTGTGAAACAGGCAAGGGGCGTCCGACGATCCTGGGTAGGT
CACCGGGCAACATCCAAACGACCTACTCATTCCAGATTTTGGCTAT