Description :
From Genome Similarity Track
Location :
Scaffold_30:380648- 389565
Transcript NameFunction/comments
Physo_134195predicted protein
Physo_134196hypothetical protein

Sequence
8917 bases(100 bases per row)
GTATTGCTGGTTTACTACGAGATCAAGGTGTTCTGTTTGCTGCTGCCAAAGTACGGCAGCATAGCTTTGAGAAGAAAGTTGCAGCCGTGTCAAAACGAGC
CCGCAGCAGGGCATCAGCTGCTGCAGTCGTCCACGCAAAGGAGGGTTGCTTCGTAGCGATAGACGTTTCACCAGTATTGGCCTTCTTCTTCTGATTCCCA
ACGCGGCGATGTGAGTCTTGGTTGCGGGCTGACGCAGCTACAACTCCGAGCGCAAAACGCTGGCTGGGTGTCTCTGAATGCGGCAGCGCCAGCGAGGAAG
TGCGGGCATCCAGCTCCGTTTGAGTAGTGGCCGGTGTCGCATACACAGTCTGGGCAAGAGCAACATCAGAGGCAGGTATGTCCAAACTGGCAGCAGCCAG
CACGAGGTCGCCACTGAACGGAGGCGCAGCTCTCGGAGCGTCATCGGCAGCTTGGTCCATCTTGCCACGCGTCCGGTGTCTCGGGCACAGTGTTCCCGGC
CGACGAAAAACAGCAAAGTAAGGAGAAGGAGAGCGAGTCGCACTGTGATTGGCTAATTTTACCCAGATGCGCTCTGTTGCAGCGAACAAGCTGGAGATGG
AGATGCACCAACTCCCTGTCTCCAGCTGCGTAGCGAACACGCTCTTACCAAAACGTACTTCAAACGTCGTGTGCACCACACCACACCACTCACCGTTTTA
AAACCAACCAAAACTGTCGAATAGAGTTCGTGCGCTTTTCGAGCCAGGATTAGCGTCGCTTGTGGCCTCCTTCACGCTGTGAGTGCTGGCAGGGTGCTAA
GTGCCACCCCATCCGTTGAGCATGGCGAAGGAAGCCATGATCGCGGCCTCCACGCTGTCCTTGAAGGACGCACAGCGGTGCTTCGACAAGGTACCCAGTC
TCTGCCTCGTCTCAGGATGTTGAAGCTGTAGACGAAAACTGTATCTATCAGCAAGGTGCCAATGTGCTGATGTTGTATTTCCAACCTGCAGGAGCGCAAA
TCGTTCCTACGCGACCTCGAGACGTTGCGGCAACAGCTAGTTAAGAAGGACCAGACAGCCGCCCGCGCAGCCGCCGCTGCCAGCGCGCACACGATTCAGC
TCAAGCGCGAGATTGCTACACTACAAACGGCTATGGCAGCCTTAGAAGCCGAACGGACGAAGTTCCAAGAGCAATTCACACACACGAGCTCACTGCTCGA
GACAGCACTGGACCAGCGACAAGAGGACCAAACGAAGCTGAGCCGCCTAAACGAGAAACTGCGGACGCTAGAGAAAAAGCACGACGAGACGGTGGAGCTG
GTGAAAAAGGAGGCAGCGGCGAACGTACGCGCTACTCAAGAAGAGCGCCAAGCACTGCGTGCGAGAGTGGAGCAATTAAGATGTAAACTGGAAAGCGAGC
GGAAAGAGTGGCAAAACGTACACCGACCCATGGCGGATGAACTGCAAAAGTGCAAGACTCGGCTGCAGCTGGTTGACAAGGAGTTGCAAGACGCACGCTA
TCGAGAGCGCTCCAGTTTCCAGTTGAAGGAAAAAATGGGAGGAGAGGTGACAATGTACAAACGAAAAGTAGCAGATTTGTCGACCGCGCTACAAGAGGCA
CTGCACGGGAAGAGCGAACTCAAAGCCGAACACTCTCTGATGATAAGGCATATGAAGGACAAGTGGCGAGAAGTGTTGCGTAACCATCAGCATTCAAAAG
AACAACTGATGATGCTGCAAGAAGACTATAACGGCTTGTTCCGCTCGCGAACATGCATTGAGCAGCAGAATGAGCAAATCTACCAAGCCATGAAGCAAGT
GAAGGTGCGACACGAGCAAGCAATAAAAGCCAAGGAACAGGAATGCTGGGAGATTGAGAAGAAGCACAAGAAGATCAGCGCCACGTGTCCACAGTGTTTA
AAAACCCCAGAACAGAAGCAGCAGGACGAGAAGCTAAAGCTTGATGCGGCCCGAGAGCAAACGCGGCTTGAAGTAACGAAAAACTTGGAGCTGGAGCGCT
GGGACCGCTTTCAAGAAGTAAACTCGAAGTACTTGGATACATGCAAGCAACTGCAAACTGCTGTTGAGGAAAATGAAGTACTGCGGGGAAAATACAAGAC
GGTGACTGCTCAACACCAAGACCTTCAGGAAACGGAACAAAGGCTGTCAAGTATGCTGAAAGAAACTCAAACCAAGCTGCGGGAAATAAATGGTAAGAGA
GACGAGGAGACCCAACAAATCGAAGGGACTAAGAAGACGATGCAAGACTTGGTTGAGAATTTAACGAGCTTGACTGCTGTGGTAAGTAGTTGTCTGAATT
CAACCGAGGGTAGGTCGGTTGGTAATTAATTGCATTTGCGTGTATGAAGACAGCAGATCAGAGCAAGAAGCTTCAGGAGCTAGAAGCCGCTCATCTGGAA
GAGGTGTGTTGACTGCAATCTTCGGCTGAGGCAATATTTTATGCACTTACGATGCTCGTTGTGGCCTCTCCAGCGTGAAACTTTGACTGAACAAATTCGC
AATCTTGAGGCAGATAAACAATCCATTGCCCAAGATCATGAGCAGCTAACGCAGCGATACGAAGAATTCCTGGCACAGTATGAGCTGCTTAAACAGGAAA
AGTCGAAGCACTGGAACGAAATTGTCGAGGCACAATTGAGTGCCAACCTTTTGATCGAGGTAAGCTTTCATGTACGAGAAAGAAACGTCAACCGGAACTC
ACGTTAGGCTGTCGATATCCCTGCAGGAACAGGCTCATACAATAGATGACTTGCTGCAAGCAAAAGCCAGTGGCACCTACGTGCCAAAGCTCTCATTGAA
TGATGTTCACGTCGACTCGTCCACCTTCTCGGACTCATCCATAGCTGCAGGAGACAATTTTACCTCGCCCGCCGAGTACACCAGCCTCATAGCTGCCTTG
CGCCAGGAATGTGACGTCCTCCGAGAGGAGGTGACACGATTGAAGGCCAGAACCCGAGATGAAAGGACTACGACGAACGAAGGCGAACTTTTGCGCGAGA
TTAAAACCTTGCAGCTGGAGCGACAGAAGTTGAAAAAACGTCTTGAAGAGCAGGCGCTTACAATTCACGAGCTCACGCTGCAAGAAGACGAGGAAGAAGA
GGGCGACGAAGAGCAAAGCTTCATATGTAGCAACGAACAGGTCGGGTTTGATCCTGGTGTGTCATCCTGTGCGGAAAGTTACCCGTCGCCAGGAAGCCAT
TCAGAGGTTAGTAGTCGGCGACTGCCTGATGGGACGTATCGTTATCCACTACGTGAACCAAGCGTTGGATTCTGGTTACCCCAAGGTAAACGATTATCAA
ACCGCCCAAGAAGCCGCAGTCCTCTAAAGGTGAGTGCGCGTGCGTAACTTTAAAGCTAAGATTGTGCTCACCACCATCGTGCCGCGTACACGTAGCAGGA
TGAACTTAGCGATGTTTTAACTACCAGCTGAACAAAGAAGATATAGTGAGTTCTGCCACTTGGCAACTTGTATATTCAACGTTGAGGCAGAACGGTTGCT
TGTCCTTTTGGGGTGCCAATGGAAAGTGGAAGTTAAACAACAACAAAAAAACACTTGGCTCAGCCGAACACCTTTCCCCGCAAAAGTGGCGAAACAAGTG
TGCAGGTATTCGAGTGCAATCTCCGTGAGCTTAAAACCGAGTCGATAGGGTCCCATAAGCTGACTGCACTTTGCCACACTTTGCGGGTATCAAATTGGTG
ACCAATGCGAGTACGTGTATGCAAGCACTGCTTGCATGCTCGCTTGTCGAGCACACCGAAATGGTCCAGGATACACTGGTCGGTTGCCGTTGCTCCAGCT
GTAGTCGTATCACACGAGTAATAATCGGGGACCAGGTGGCTGCACTACATCATGTTGTGGGCTGGAGGGAGCTACAAATCGATAGCAAAATGTAGCGCCG
ACGAGCGCAGGCACCTTTACCGAGGATAACCCGCTCAAGGTGAGCTAAGACGCTCGACGACACCGAAACTAGAAACGCGCTCGGACATCTTTATATGGGC
ATCTTCGGCTGTGCTCGAGGAAAGGCAAGAACAGCCCGAAATGCTGATCCTGATCCTTGCGCGTTTCTGGCATTTAACTCGCGGAGGATGTAGCGATGCA
CGGATTAATCAGCAGGGACAAGGCCAATCTGCTGGTGCAGTAAATTGCGGTGCAGCTCTTGATACATAATAATCCCAACTTCCTCAACGAGGCGGAGCAG
ACTTTGCTGCTTGACTGGATCGTACAGGTATCATACCAGTTTGTGTCGTCGAGAGGGCACTGCCTTGCTGCTCATTGTTCTTGTCACCATCAATCGTGGT
GCGGTCAATGAATGCAACACATGTATCAACCGTACTGCGTTGTTGGCTGCAAAGTAACCGCGTTGAACGGATTAGCACCGAAAAAAGCTTGGCAGTGGCG
AGCGAGCTTGCTGTGTTGTGCCTTCTCGTCATTATGCTGCGGCGAGTTCCCGATCTCCTCGCAGTACACAAGTGAGCGCCCGAGGCGGCGAGCGTGTCCG
TGTAAAGCGATGGTAGAGGCCGGATTCCCGGACCTTGAGTTCTTCTCCGGCCAGATCCTTATTTGCTTGGAGGATAGTCGTAGCGCGCGTTTCTAGTTGT
TCGAATTACATACAGAACTTGTAGCCCACCATCGCGGCTCCCTTCGGCAAACACCGCTGGGACGGCGACACGAAAGTGTCAAGTGCGAGCCTCAACAGCC
CAGCTCGAGTTCTCCACTTTGCTTTTTGCAGTCCAACTCCAAGGGTACTTAGGTGTGCATTGGCGACAACAGCTATGGACCGCTCGAGAAAAGAACCTGG
GCGTGGTAAGCCTAAGAACGACCTCAAGATCACTCCGGCCAAGACGCAGGCCCTCATTGACGTGTCGACGCCGTCGCCCAATGCTCCTCGCTTCGGTGAC
AAGTCGACGCCAATGATGTCCACGATGGTCAACATGAACCAGAACCCGCCGCTCCGAAAGCCGGCAACTGCGAACTTTATGGACAGCAGCAAGTTCATGT
CGATGAACTCGACCACGACCCCCGCGGTAGGCAACTGCAGAGGCAGCGGCAACAATCGCAGATCGCATCGTCGCCGCGCCAATGTGGACGCTATGATGCG
CTCCAACATGGTTCGTCAAAGCTTGACGTTGTCAGCGTCGAGTGTGTCCATGACTTCGACTGGGCCACGAATGAAATGCCGTGTCGCTCCACCTGCACCC
AAGGACGACATGTACGGCCCACCTCCCGGAAGCGACGTCGTGACCGTGCCGATCCCGGGTGACTGCAACTTCGAGCAGAAGTACAATGTGGCCATGAGTA
TGGATGAGAAGGCCTACACGCCCATGGAGAAGCTTGAAGCACTCCGTGACGCGATGGGAAACATCACCGACAAGGATGGCTACATCGAGCGCGAGACCTT
TTCGCATGCCTTTGAGGTGGACGGCAACGATTTCGATGGCTATGCTACCAGCAACGGTACGATCGACGGCAATGCCATTTTGATCGACGCCGTGATGAAG
CTTGGAGTGAACGCCGAGCAGAAGCTGCGCTTCATTTTCGACACGCTGGACCCCGACAACACGGGTTATGTGGTCGAAGATCAGATCGTTCAGTTGCTGG
AGTCGAACTTCTCCAGTGCGAGGATCGACGTGGTGGGCATGAAATTCCAGACGGTGGCGAAGCTCATGTTCCGCAAAGCTCGAGTTCAAAACGACGCGAT
GACTTTCGAGCAGTTTTGCAACGTGTTTGAGCCGTACGTGACGGACTCGTACCACCTCGAGGAGGCCAAGCCGGTTTACTCGGCACCTATTCGCCCCAAG
AGCAAGTTTGGTCAATGGTACAGCGACAACAAGCTCCGCATCTGGTGGCTCCTGTTCTACTTTATTGTGAACAACATCGCTTTCTGGGTCAAGTGGTTCA
TGTACGAGGTCGATCCGGCCATTGGTTGGGGTCTGCGCATCGCCCGCGCCAACGCGCAGGTCGCTATGCTCAACTGCGTGTTCGTGTTGCTCCCCATGTG
CCGATCCATTACGCAGGTGATGAAGCGCAGCAAGTTTTTGTGGCGCATCATTCCGTTCGACGACCACATCGCTTTCCACAAGATCTCCGGTAGCGTTCTC
TTGATTGCTGGCCTCATTCACACGATCGCCCACGTCTTCAACGAGATCTACCTGTACCTGATCGCCACCCCAGACGAGGTCAAGCGGTCAATCTTCGTCA
CCCGCCACGTTTCAACGTTCGTGAATGGTGAGCGTCCTCCTTTCACGACAATGCTGCAAGCACTTCCAGTGTGGACGGGTGTGATTCTTTTGGTGATCAC
GTGCATCTCGTTCCCGCTCGCTGCGATCCCCAAGTTCCGGCAGGGCAAGTTCAACCTCTTTTGGTACTCGCACATGCTCTTCGGGCCGTTCCTGGTTGTG
CTGGCCTTCCATGGAGCCACATCATGGCTCGCTCGCTGCTCGGCGTACATTTGGATCACGCCTCCGTTCTTGATGTACTTGATCGAGCGTCGATTCCGCT
ACGCCAAGATGTTCGCAGCGCCTGTACGTATCATGGAGGCGATGGAGCTGGACAGCACCGTTGCGCTGTTTATCGAGAAGCCCCGACGGTTTGTCTACAG
ACCTGGCATGTACCTGTACATCAACTGTCCCCAGATTTCGTCCCATGAATGGCACCCGTTCACAATTTCGTCAGCCCCCGGTGACAACTACATCAGCATC
CACATTCGTGTGTGTGGTGACTGGACTGATGCAATGGCTCGTGTCATTGCGGACTGCCACGCGTGCAACCTGCAGTACCCTGATGTGTACCTCGACGGTC
CTGTTGGTGCTCCAACCCAAGACTACCACCGCTACAAGACTGTCATTTGCATCGGTGGCGGCATTGGAGTTACCCCGTTCGCCTCCATTCTGAAGGATGT
TGTTCACCTCTGGGAGGACAATCGCTGCCTGAACTGCAACCACGTTCGACACCCGAGCTCGTTCCAGATCCAGAAGCTGTACTTCCACTGGGTGACTCGC
GGTCAGGAATCACTGAGCTGGTTCGAGGGCACCATGAAGCAAATAGCTCAAATGGACCGTGACAATGTGATCGAGACGCACCAGTACCTGAGTACCGTCG
TGCTCGGTGGAGAAGAAAACACCTCGCAGCTCAAGATGTTCCAGGAGTTCGTTCATGAACAAACGGGCAAGGATTTCGTGTCTGGAATGGATACCAAGCA
GCTCACGCACTTTGGCCGACCAGACTGGGAGAGGGTCTTCTCGGATGCTAGTGCCAAGCACCCTGGTGAGGAAGTGGGTGTGTTCTGCTGTGGACCCCAC
GAGCTGGAGGAAGTTCTGGCCAATGTGTGCAAGAAGTACACGTCCTCCAAGGCCGACGGCACCGTTTTCGACTTCCATTCGGAAAAGTTTGCGTAGACGT
CGGATGAACCAACGCCAGAGTTCCTGCTGATCGAAAGCGGGCATATTCATGTCTTGATGTAGCCGATATTGTCGTATCTTACATAGTGCTGTTTGCCGAA
TGCATGTATCTTTGCTCTAAGTTTTTTATGCTGCCTGTGTGAAATCGTTAACTTTCGTCAGAGTAGTACTACGCTGATGCCGGTCGGTACTTGTGGCGAA
GTTTCGACGAGTTCAAGGGGCAAATGATCGTTCGCGGGATTTCAGGTACGAGAGCTCGAGCTCAAACATGGAGTCCCAGAGCTTGCCGGTCACAAACACG
TGACGGCTCACCGGGTCGTAGGCAATCCCATTCATCACTGCATCCTTAATTATGGGTGACCTCTTCATGGCCTTGGTATGAATGTTGGCCACCATGTTGG
GGATCCAGTCCAGGTCGATCTGCTCCAGCACGTCTCCTGTCTCGATGTCAATACGCAGAATGTGGTCCTCAAACCACACATTGGCGAGCAGTTCTCCCTC
TACGAACTCGAGTTCGTTCACATTTGTGACCGGCACGCCGTCTTTGCGAACGGTGATGCTGTGGTGCAGCTTGAAGTCATTGTGCGGGTCGAAGAAGAGC
ACCTTGGCGGAACCGTCACTGGCGATGAGGAACTCACCATCCGTGGTGAGTCCCCAGCCCTCCTTGGTGGAAGTTGAGAGGGGGAACTGACCGATCAGCT
GGAAGTCGCGTCGAGACAGCACCAGCACCTGCTCAGCCTTGTAGGTCAGCGCGAACAGCTTGTCGCCCAGCACAGTCACGCCCTCGCCGAAGATGGCATC
GTCGAAGCGGAACTCCTGCAAGTACGGCACGCTCTGCGTGGTCCCCGCCCGGAAGAACTCGGGATTGAGGTCCGACAGTCTGTACTTGCGGATGAAGGAC
GCGCCGTTGAGTCCCGTGGACTCGATGAGTGCGCCGTCGTCGAAGACGAGTCCCTCTGTGAAGGCGCTGACGTTGTGCGGGTGGATGGTTACGAGACGCA
CAGCTGTGCGGGTGCCGTCGCCAGTCGCACCTACGCAGCTGAGGCAGGCCAGGGCGGCGAGCAACAGGAGCAGCAATCGACCACCCATGGGGTGCGTCAG
GAGGGCACCATCGCCAGTCGACGACACCTTGGCGACTGCGCGGCGGTGCATTTGGCCGAAGTGCTGATGGCGCCTTAAAGTAGGTGGACTAAAATATGGA
TGGACTAAAATATGGGCGGACTAAACAAAGTACAAAAAGTGCTTCTAACCCTTCCCCTTTTGACATTCGGGGGGATTTTTTTTCCATACAAGTCCAAGTG
TTTAAGCGCCCTGAAATACAGACTTGTATTATAGGTGTGCACACACACTATTAATAGGGTGTGGCAACACAACACAACGCAATTGGGAATTGGCTGGTCT
CAAGGTCGGGGCTTCTTGAGAAACATGTTTTTCACCGTGCGTACACCTGTAGGACGTGAGTGCTGGCAACAACCTTACAGGATCGCCACTCCTCTCCGGT
AGCGCACATCGCGCTCG