Description :
From Genome Similarity Track
Location :
Scaffold_1420:3806- 9911
Transcript NameFunction/comments
Phypl_g13362hypothetical protein
Phypl_g13363hypothetical protein
Phypl_g13364hypothetical protein

Sequence
6105 bases(100 bases per row)
CTACCGGCGGCTCTAGCGGCTTCTCTCGGCGGCCGATCCACATTGACTCGTCTGACTCAGCCCCCAGTGATCACGCCTATGTCAGTGGACGGACCGATGG
TAGCCGACCCGCCGATGGTAGTCGACCCCGATCTAGCTCCGTCTTCAGTCGAGGTCGGAGCGCTGCtagtggcggcggcggcgaaaACGACGGGGGAGTC
ATCGAGTAGTGCGGCTCGAGTTCGGGAAACACCCTCCTTTCGGACGGGGCTTTGGATAATCTGGATACAACCTCCATTCCCCGTGAGCAATGGATTCCTG
GTTACAGGCGTCCTCGACCCTACACGTCGACCGAGGTCGCCCCATGGCCCCTGCCTACCATTCTTCGCCTCTGCGTTCGTCGCTTGACTCTGGATGCGCT
CTTTCACGAGCTAAGCCGGCCGTCAGCTTGGCTTTTTTCCTTGTGGATTCGAACCCccgcgccgtcctcctgGCATCCGGAGCTACTTACCGAAAGAAAC
GTGAGGGCTTTGATCGCATCGAAACCTTGGCAAGTGCTGCGGGTGCTAGTTACGCCCCGGTCCTTTGAACTCATCGGCTGGTTTGATACCCTCGCTCGAC
TGTACGCGATGTTCGAGGAGGAGTTCATCCAGCCTTTCTGGGAGGCGGCGCACTTCTTCCCGATCAGTGGCGCCTTGCAGACACGCGTCCCCTTTCTCGC
CACGTACTACGCCGGACGCAAACAACGGCGACCGCGTGACGGCGCTCGCTGGAAGTCACTGTGCAAACACATCCTGCAAGAGATCGGGCAAGGGCTGTAT
GATCTCGACATTTCCCTAGACCCGTTCTTCCTCCGTCTTCTGCGCAAGACCGACCAGGGCACATGGTAGTCCGGGTTGGGGTCCCACCAACCACCGACCA
ACTTGATCTCCGCCTTGCAAGACTTAAACGTCGATGAACCGTGGTGCAACCAGTACCGCGATCGACTCACCGACCACCCGGCTGTGagcctcgagcgcct
ggaCGGCAAGTTCGCGTCGGTCGCCGGCGTTCCTTGAGACGTATCTAAACATAGCCATTTCCGCGGCCGCTTCTTTTTCGCCATATACACGCGTCATTTC
CTTGTGAGTCTGGTCAGGCTTAGACCGTCGTGGACCAGCCACCCGATCTCACACTCATCTCTCAAATAACTCCCCTTCCAACTCCCTGTGCGGCCACCCC
ACACAGGCTCCCACTCCGGTCCCCGCAACGGCCGATCCGCTACGgttcctcctcttccgccTCGTACGACTGGATCACCTCAAAGCGATTTCGGCTGGTG
GTGTTCCGCTCAAACTCCCTCAGCAGGGCGCCACAGTTCAAGTCAGCCTCATCCCCCTACGCCGGCTCGTCGTACCCCTTCCAGAACACCTGAAACTCCC
GGTGTACTCGCCCGTACCGCGTCCTACGCCCGGATCGGACACCCGCGATCCGCTCAActtcgaactcgtcctcgtccagtACTCTCTCCCAGCTGTCATC
CGGCAGGAGTGCCTCATCAAATTCGAGTCGGTCGGATTCGTCCGTAGCGAGCGACGTCACCGACCGATCAGGGAAGACCCTGACCAGCTTCAGTTTGGAC
ACGTGCACGATCGGGAAAATCCTGTACTCCGTACCCTCCACCTCCAGTTGTGCAGCGTACCGAGCAACCATATCTGCACGCGGAACGGACCGTACCACAt
gtgcgccagcttcttcgcgtagTCTTCCTTCACCCGATCCAAGAACAGCCAGACTTGTGATCCGGCCTCGATCACATGCGGCCACACCTCGTCATTGTGC
TGGTCGGCTCGGACTTGGATCGCTTCTCGAAGACGCTCGCTGACCTGTTCGCGGGCGCGCGGGTACTGCACCTGGATGTGGTACCGCCATCTGCGCGGAT
CTGGGTCGCGGCGACGCGTGCTGCCTAGCGGTAGCGACGCCTCCAGTGTCGACCTCGGGTCCCAGCCATGCACCAAGTAGAACGGGGTGTCGCCACGAAC
TCGATCCTGAGCGGTGTTCAACACGAATGTGAGACGCTCCGCGTACTCGTTTCAGTCCTACTGGTTGACATCCGCCACGTACACCTTGAGCGCGCGCGTC
AGTGTCTGTACCATGCGTTGCGCCGTACCGTTGGCCTGCGGTCAGTacgccatcgtcgctctCTGCCGCTGGCCTACTATACGGTTAAAAGCCCGGAAAA
ACTCGGACATAAAGCCGGGTTCACGATCACGCTGGATTGCGTCACTCGCTCCGAAGCGCCGAAACACGCACTCCTCGTAGTTCTCCGCGATCGTCTGCGC
AGTGCGCGAAGCGCTTGTTTTCGCGATCACGTACCCGGTAGACAAGTCAACCCAGATCAGGAGCTCGGTGATTCCCTTGAACGACTTCGGTAGCGACGGG
ATGTGGTCCATTGCGACTATCTGAAACGGGTACGTGTATCGCATGTTCCCCGGCGATTCCCCCGGATGAGTGGTCATCCCTTCCCAGTCTCATAATCAAC
GCATTCTCCCGCAAACCGTTGGACACTCCGATACAGACCTCTCCAGTGAAAGTACTTCCTGATCCGCGGGTAAGTCCACCCGATACCTTGGTGCCCGCCT
TCTAGGCTTGCATGGTAATTATGGAGGAAATCTTGTTGTAACGTACCAGCCCCGCGAGCGAGTCCCGATCTTCATCAGCTTGCTTGGCCACCCGGCAGAA
GAACAGCAGATCATTCTCATCCAGATCGTAGTCGCCCGCGATCTTGGCTTCCGCGGTGCTAAGATCGGGCACGTCACCCCGAAGGTAAGCCTTCAGGTCT
GCGATCCACTTCTCCTCGTTCTGAGCATGGACAACGCCTCACCTCTCATGCGTTGCACGATGGTTTCTTGCAGAACTTCGGGTTTCAGAGGCCGTCTTCC
TGCCGAACTAGTGACAGCAGTCACGCGGACGACCGTGTCAGCCGCCTTTGGCTTCAGAAGCTCGTCCAGCCGGTTAAGCGTGGTCAAGTCCTGACGCTCT
TCCTCCGAGGTAACcactgcgccttcttgaccttgTAACGCGGCACTTGCTAACCGATCAGCGCTCTGATTCCAGTCGCGCCTCATGTGCGAGAGCTCAT
GCTTCGGCCACGATCTAAGTTTCTCCGGCGCCTTCTGTCGAAGCAGTTGCAGACCAGGCGCCTTGCAATCGATTTCGCCCCGCATTTGCCTGATCGCCAA
GTTGGAGTGATCAGTCGCCCCCTGTCCAGATCGAACCGGATATCGAAGCACAACAGCAACCCTCGATACTCAGGTTCGTTGACCGTCAGGTCGGCCGTGT
ATTCCGACGCCACAGCGAGGATCGTCCAGTCGGGGAGTTTCCAGACAGTTGCACTATAGGCTCCGGCCTTTCGCTTGACGCTCGCGGATCCATCGAAGCT
GACGACCAGCAGATTCTCATTCTGATCGACTGTCGGTGGCATCATGGCGACTATTTGACGTGGCTGTTTCTTCGGAGCGATCGCGATCAATGTCTCATCG
ACTTCGGATCGAGGCGTGATGCTTGCTGCGATCGTGCCAAGGATTTTATCCTCGCCCTTCGTACACTTTCGGATCTCAAGTGTTCATTCAGAAAGCAACG
CCGCCCATCGGCCAAGTCTACCGTCCAGTCCAGATGAGTCCACCAGCCACGCCAGCGTCGAGTGAAGCGTCAAAACTTTGATCGACCGCGTTACGAGTAG
AGTGTAGCAAACGGTCAAGCCTCGGAGGAGGGCCAACATCTCTTTATCGACCATCCCGTAGTTGATCTCGTTTGCCTTCAAGGTACGGCTAGTGAAAGTT
ACTGGCCAATATACACCGTCGTGTACCTGCATTAGCGCCGCGGAGATCGCCTATTTTCTGGCGTACACAACCACGACTGGAGTTCGATCCGAATCAAAGT
GACGAAGTAtcggcgtggacgtgatCTTCGCGTTTAGCAACGTGAACGCGACCGTCGCTCTCACCCAGTGATCGTCCTCCTCAGGTGGCAACGTGGCGCC
CCCTGTCTCTCGATTCCCGGTAACAACCTCGCTTCGTCCGCGGAATTCGTGGAAATCCACTTCTCGCAGCTCGTACAAAATGGCAGCGTAGATCGCGAAG
TCCTCTATGAAGCGGCTATAGTAGTTCCAGCTGCCCAAGAAAGACTGCATCGATCGTAGCGTACGCGGGATTGAGAGATTGGCCAGGGGTTCGAGGTCCT
TGGGGTAAGCCTCCAGTCCGTCTGCCGATACCTGATGACCCAGGTAATTGACCTTCCGCTGTCCCCAGACACGCTTGACGACGCTGATCAAGAGATTCCA
CTGTTCGCAAGCGTCCAGGAGGCGGTCTACCTTTGTGCAGAGAGTGTCCCAAGATTCGGCCGTCACCaagatgtcgtcgatgtacGATCGCCGTCCGAGA
ACGGGCGACTTCTGATCGGGGTCCGGTTCGCCACTCTCGAAGACATCACTCGTCCCCTTCCCATCCGGATCCGAACTGATCTTGAGGTGTCCGTACAGAG
CGTTGCCGATGAGTCGCTGATAGATCTGAGGCGCGTCCTTCAATCCGAATGGCATACGCAGCCACTCGAACAACCCGAACGGGGTGATGAACGCTGAGAT
CAACCGCGCCTGCTCGGTCATGGAGACTACCCAGAATCCGCTCACCATGTCAAGCGAGCAGTACCACAAGATCTTATCCAAGTCTTCCAGAAGATTGTTG
ATCAGCGGCATCGGATACACCATCAAGCGCGTCAGGCCGTTGACGACTCTGTAATCGATGCAGAGTCGTATATCAACACCATTCTTCTTGATGATGATCA
CGATCGGGGATGCCCACGGTGAGGTCAAGTGTTTGATGATCCTAGCCGACACCAAGCCCTTGATCAGCGCAGCCAACTTCTCTCGAATTGTGGAGCAACT
GGTCGCACACGATGGGCTACTGGAGTGGCACCACCAACTTCGATCTCGCACACTGCACCGCGTGCCGCAGGTGGCAGGGCGTTCCTTTTGCCGATCAGCA
GgtgccgccttcgccagATGATCCATCGCAGCCGATCGATCTCTTCCGGGGTATTCAGATCGGATCGCGAACCTGAATGTCTTCGATCGTTACGTCTTCG
GTCGAAGCCGCTACCTCGGGCAAGATGGCCAAGTCCCGATCGAGATCTTCTTCGACAAAGCATCCGCCCTCATGGTAGCAGACCTGTTCTGCCATAGCTT
CTTCCGAGCTCGACTCCTTTTTCTGGATCGATGCAGGCTCCCGGGCGactcgctcttcgtccgGCTCTTCACACTTCACTTCGGCTTTCGGCAGGCCTTC
CCGTGTTCCTTCGCAGGTCGACGGTAAGGCTGTTGCTACGGCCACCACTGGTTTAGGAGGCCCATCCGACCGACTCAGAAttcgcgtcggcgtcggatAT
CGAGGCCGATCCACCAGCGGTTCCACTggctcttcttcgcgtccTGGTTCCTCCTGTCGCTTAGTGGTAGCCTCGAACGCAAGGTTCTGCCATTCAGCGT
ATCTGCGCGATCCGACTGACACAAACCCCGGCATGCGAGGTACGGTGTCTGGGGCTAGCGAGATTCCCAAACGTTCGTGTCGATCAAGTACTAACATCTC
TTTACTCACGTTTGTGATCCGCAGATGCCTCGTCCGGCCCAGACCCTTGACAGCGGTCGGTACCCATCTTGGACCTCGTGTGATCCAGAGCCTTGCTGTG
GCCGATCGGCCATACCGGATCGGGATCTCCACGGACTCGGCGACTGGCACTTCAAGATCTTTGATCAAGCGTGACGGGCTGGACATTAGCTCCGTACAGC
TGACGCCGTCCTAGCAGCTGAATCAGCACCTCATTAGGGAGACAGAACGTCCCATCAGCTAGATCGAGGCGCACTCCAGCGGGTACCATGAAGTCCATAC
CGAGTATCGCTTCCTGCCCCGACTGATCGCCAACCCAAGTGTCGAAGTAGTACACCAACGATCCAGCCAGCGTGACCTTGACCGTGGTACATCCAACCGT
CATTTACGTGTTCTCTCCGATTCCGACGCACTCTTGCTCTGACTTTCGTCTATGACACACCCAACCTTACGAGCAAAGGTGGTGTCTATAATTGAGACTT
CAGCG