Description :
From Genome Similarity Track
Location :
Scaffold_30:380493- 382628
Transcript NameFunction/comments
Phypa_INRA-310PPTG_12466beta-glucan synthesis-associated protein

Sequence
2135 bases(100 bases per row)
GGCATCGACAATACGCAACATTAGCTACGGTCGTGGTTTGGGTGGTCACGCTAGCATTCGTCACGGCAGCTAAGAACGATACGACGGCAGGTACAACGTA
CCCGACCAAGTCTGGCATCAAAATCTGGGTCGACCCTGCAACGCCCGATGACCGACAAACGTACACCAGTTCACGTGGCAGAAAATGGGACCTGGTCATG
AGCGACGAGTTCAACACTCCCAACCGTAGCTTCCGACCTGGTGACGACCATATCTGGACGTCGCTGGAGAAACCCGATGGTGTCAACGGTGCACTCGAGT
TGTATTCACATAACATGACCTCAACGAAGTGTGACGACGACGGAACATGCTACTTCTACATTAAGGCTGTCGACGAATTGAACGTGATTCATGTGTACAA
CATGTACACGCACCCTCCGGGATACGTCGATGCTTACTTCTTCTACCGTGCAGCAATGGTCCAGTCTTGGAACAAATTCTGCTACCAAGGTGGCATGATC
GAAACGCGCGTACAGCTCCCGGGTGTCGTCACTCCCGAGTCTGGTAATCCCGACCTTGCCAAGGGGAAGAACTCGAAGGTTGAGGCGACGAAATTCTACC
CGACCTGGCCCGGTATCTGGATGATGGGGAACCTCGGTCGTGCCATTTTCTCGGCCTCAACGAACCGCATGTGGCCGTTCTCATACGATAAGTGTGAGCC
TGATCTGTTTGACCCGAGTTACCAACGTATCAGTGCGTGTAATGACAACCCCGGCTACGGATTGAACCCGAACCAAGGCCGTGGCGCTCCTGAGATTGAC
GTGCTGGAAGGCGGTGCTACTCTTGTGTCTTCGTCGCTTCAAATTGGACCTGGTATGCCGGATGAATACCGTATCATCGGTGTTAACTACTCATCGGGAG
ACAGTTCGTCCTGTATCTACGCCGGTACTTGTATGAGTCCCGGCGCGAACTACGTTGACGTCCCGACAGCGTACTACAAGAAGGAACGCGGACACAAGTC
ATGGTACCAGGGTCTGCGTTACTCAGCCAACAACTACTGCCAGCAGGACGCCGACGCGAAGCAATCGTACAGCACAATTGCTGCGTCCGTGAAATCTGGC
ATCACTGAGAACTCATGCTCGGTGGATATTTGCCCTGCCTCGAACGATGTCAACGGCGATTTGAGCTTGATTGACAGCAAGGGCGAGGATCACTGGGGTA
TCAACACAAACGGTACCTGTTTCCCGCTGTTCAACGTGTACACCGGTGCCTACTTGTGTGACCCCGACAACACATTTTACAAGTGTGCGAAGCCACGAAA
TGAATCTACTACGCCCAAGTCGAACGCCATGAGCCAATTCAACTATCAGATGGACGCCATCTCGGCCAATTGGCCAGTGCACCTCGGCGCGTACATGGAC
TTTGTGACGTACCAGCTCGAGTGGGTCACCGGTAAGAACGGCTACGTGCGATGGAACCTCATGGGTAGCCCGCTGTTTGAAGTGCCGTCCAAGTCTATCT
GGGATATCCCACAGAACTCGAACAAGACTAATCCGACCAAGGCGATGCTGGAGGAACCGATGTACCTTATCTTCAACGTCGCGTTGTCGAGTTCGTGGGG
TGCCACGCCTCCCAACCCGGGCAAGGCATGCCGCGGTGACGGCTCTGATAAAGTGGCTAATAAGATCTGTGACGCCTTCCCGTTGTACCTGAAGATCGAC
TACATCCGTCTGTACCAGGACTTGGCAGACGACCTGGAAGAAGACAACTACATGCACGTTGGCTGTGATCCAGATACTCACCCTACCAAGAAGTGGATCG
ACGCTCATATCGATGAGTACGAGGATGACGACAATAAACACAAAGTGGTTGCTGGCAAGGCGTTCTGTACCGTGAATGATGACTGCACGATTGGAGGCAG
CTTGGGTAAGACACTGCTAAAGACTGGCAAGTGTGTGAAGGGACGATGCCAGTGCACGTACTCGTCGTCGTGGGGCGGTCCGCGCTGTACGACGGCCGTC
TCGGGATCCTCCTCGACCACTGTTGCCAGCAAGTCCGTCAGTACCAACTCGTACGGCCCCCCGTTCGGCATGTCGATTGGTATCGCAGCCATCATCGTGT
TCCTGAGTTTCGTGTCCGTCATGTGGTCGTCCATG