Description :
From Genome Similarity Track
Location :
Scaffold_1:3804741- 3807119
Transcript NameFunction/comments
Phypa_INRA-310PPTG_01036hypothetical protein
Phypa_INRA-310PPTG_01037hypothetical protein

Sequence
2378 bases(100 bases per row)
TTGATCGCGTAATGGCAGACGCAGACTTCCACCAATAATGCGTGAATATATGTTGAGTGTAAGGAGAGAGTTTATTACGAGAAGATGACAACAATACCAG
TGCTTCCAAGGCTGGTGCTGTGGTGCAGTACATGTATACGCTAATAGCAAGAGATCTGCATTGAGTGTACCACGCAATTTTAAACATTTTTCTCTAAATA
CCGCATCAATACCGGTAGCGACCCCCACCATATGATCCTCCGTTTTGTCCATTCTTTAACGAAAAACTTGGTGACAGTAAGGAGAGCCTTTTAGAAACGA
GAACTTCTTGTGGGCTAAAACTGTATGCTCCTTCCGAGTTGAAACCGTACTGCCTCCACTCAGTGGACATACTGTATTCGCTCGATATCGAGAGAATTCG
TTATCCGATCTACAGGTTTAAATTGAATTTATTTAGTCTACAGTGGCAAACATAGCAACAAAAAGAAGACCTGCAATGCCAGTCATTTCGGACAGTTCTT
AGGATGCCAATTTCGTTTTGTAACAAAGCGTATGAAATAATAAAAATATTGGTTTGCTGAGTAATCCACCCAAATTGATGTAAAGATCATAATATTCTCT
TGTGCAGTTCTGTACCCTCTGCATCAGATCGTAACCGCCGGATCAGACTTTCGATCGTAAAGGTCAGTCCGCGGAAAGAGCGCAGTCGACGAGGCGTGCG
CCGACATGGAGGATCCTAGCGAAGACGATGCGTCTCCATCACCCCCAACACCATCCACCTCCACACAAGACACAGCGACATCCAACGCCGCTGTTCCCGC
ACCAAACAACCTCGTACAAGCGCCGCAATCCCTCTCTAAAGTTTCTCCCGACTCTCTTCCCGACTCTATTGCCCCTAAACAGACTACACGCAGCCTTCTA
ATCCTCCAATTAGAGCGCGAAATGCAGAAGAGAAGACCCGACCACTTTGTAATTGGTGTAACGTGTCGCTCGCTCGGTGGTGTACCCTCTAACTTGCGAT
CTCAAGTGTGGCAGGAGCTTCTGGGCGTGGCTCGTACCGAGCGACTGAGTCTGGACCAGAGTATCTTACAGGTAGAGGAAGACCTGGACAACCAGCGAGT
TATCGCCGCCGATGCAGCCAGAACCAGAGGCAACGAGCCTCGTTTCAAACAACCAGAGACTGTGGAGCTCGTGGTCAAGCTGCTCACGTACTACTGCAAG
TGCCGCAGCATCCAATACAAACAGGGAATGAACGAGGTGCTCGCCCCCTTCTTACTGCTTACTGAGCAGCGAGATGGGGCTCAAAAGAGAGTCCCATTGG
CCGAAGGAGTCGTGTTCCAGTGCTTTTACGCGCTTATCGACAGGTTTCTGCCCCATGTGTTCGTGGATAAAGAGTTCCGATCACTGCAGTGTTCCTTCCA
GTTATACAGACTCTTAATGCTGTACCACGACCCAGAATTGTGTCACTATCTGGACCAGCATGACATGACTCCGGAACTTTATGTGACGCCGTGGTTTATG
ACGCTGTTTGCGCGCTCCTTACCGCCCGAATTTGTGTTTTATCTCTGGGATTTTTTCTTATTGGAAGAAGACCCGTATTTACTGCATTTTGTGGCTTACG
CACTGGTCGCAGCGAACCGGGAGAAGATTTTTGACGCGGATATTGCCATGCTACCACAAGTTCTGAGTTCTCTGACTTTCTCGTCGCGTGATGAACTGGA
ACAGGTTTGTGCCGATGCATTGGCGTTCTCCGAGTTGACACCAAAGTCGTATAAGCGAGATTTGTACTCAGTATGTTATGGGGGCTTCACAGATGCCATG
GTGCCGTTTCTAGATCAACTTTACGCGTGCTCCAGTCTGCAAGTGTATCCAGAGGAACTAGTACGCAACTTGATGGACCGATTAGCGACCAAAGCGAAGG
AGAAACGGATTCCAGTGCCCTCAGCCATGCAAGAAGAAGATACAAGCCTCCAGGATTCGTTGAACCCGTTGCTGTCACCTGCCACTGAAGCTCCGTTGTT
ATATTCCTCTGGGAACGATGCGGATGAAGTGACGGCGTTGAAGTTTATCGTATTGGATTGTCGACCTGCAGAGGAGTACCACAAGTCGCATTTAAGTCTC
TCGCACCACATTGATCCGAGTATTATGGGAAGACCAGATGCTCTAGATGGACTCATGAAGGGCTTCTCACACATGAAAGGCTGCCACTTTTGCTTCGTTG
GCCCCTCTGTCGTGTCGCCTCCTGTTCTACCGAGATCCTCGTCGAATAACGCGGCACTGAACACTATTGTGCGTCTGGCCAGAGTCATTTCTAACGATAA
ATCTGCACTAGAGCAGAGCCAGAAGCCCATTGAAGTTCAAGTAGAGGAAATCATGTCGTCGCCTCCAACTGGACCCGC