Description :
From Genome Similarity Track
Location :
Scaffold_129:38045- 40388
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_14406ankyrin repeat

Sequence
2343 bases(100 bases per row)
CGAATTCATTCCCTTGCATGTTGAGGCTCGATTTCGCGCGTTGAGCAATGGGGTGTCGACAATGGTACCGCACGTGGCGGTGGTTGAAGGATTTTTGGTG
CAACGAGACTGCACCGCGATCGTACGGTGGGGATGCGGTGACCCAATTCAAAGCCATTTGACGACCCGCGATACACGATTACCACGAGGCGAACAGCCTC
AGCAATCAACAGCAACGCTGTATTGTAAACACTGCATTGTACACTGCATTTCTATGTTTACGCTCCCGTCGACAATCAACATATCCTTTTCGCAGCGAAG
CATTGTGGCGGCACGGCAGCCCGTACGCGATCACTGCGGCACGTGGTCGTAGCCGTGCGCGACCAGCCTACAATTCATGCCATGTATCAGCCACAAGGAG
TCGATATGTTCTCTGGAACGTACCATGCTGCCATGTCGTTATGGTGGTGCTGCTGGGCCCACTCGAGGGCGTTTTGCGTGCACCCTTCGCTGCGATGTGT
GTGCAAAAAACGCACAATATCAAGCCGCCCTTTGGACGCGGCCCAGTCCATGGCCCACGTCGTGCAGCCTTCGTTCCTACCATGTGTTCCATCAATACCA
TTCCATCTCCATCGATCGCCTCGCACCGATGGGCTTGAAGCCACTGAAGCACACTGAGGTGACCATGGAGGGCCGCATAGTCCATGCCCCGGGTCGACGC
CCCGTCATTTCTACAGCCATGCGTCGTCGTCACAACAAATACGACGTCACGGTGATCGTGGTACCGGTGGGTGTGCAGCCATTGAACAACGTCCAAATGG
CCGTTGGCGGCGGCGCCGTCGATGGCGCGCTCGGTGGCGCCTTCGTGCCTGTGGAAATATCGTCATCATGTCAAAAGTGTCCTCATCGGCAAGCAAGGTC
GTACCGATGCGCATGCAACCACTGAACAATCGCCAAATGCCCGTTGCTCGCGGCGCCGTTCATGGCGTGGACGGTGCAGCCTTCGCCCTAGTACGTGCCA
TGAGCCAACTTCAAACAACGATAGATATTGCCGCTCCTACACGGTAAGCGTGGAGAAAGTCGACCACGGAGAGATGCCCGTGCGTCGCGGCCAGGTCCAT
CGCGTCCGTCGAGCAGCCTTCGTCCCGATGCGCATGGAGCCAGCGCACAACGTTCAAATAGCCATGCTTGGCGGCGCCATTCATCGCCCGCGTCGACGCG
GGAAGCCCCGTGCGTGCAGATACTCGACCATAGCGAGGTGTCCGTTCGTCGAGGCGCCATCGAGGAGCGCAATGTCATACGGCCATGCCGTCATCGCTTC
GAGATACTGTACAATGGCCAAGTGGCCGTTGGTTGACGCACCAATCAGCGCTTTGGCCGAGCACCCTTCCGACCTACCATGGAAAGTGTCCTTATCAACT
TGCCAATTCGCGATATGGAGATGTCAGAACCCTACCGGTGGGTGTGCAGAAAGACCACGATCTCATAATGACCGTTAGTCGCCGCGTGGTCCATGGCGGC
GACCGAGCAGCCTTCGGTGCGATGGTGGTGCAAGAAGCAGACAACCTCCAAATGGCCGTGCTTGGCCGCTTCGTCCATCGCATGGTACGTGCACCCGGCG
TTGCTGTGCGCGTGGAGCAGTTGCACCATCTCCAAGTGCCCTTCTTTGGCCGCTTGGTTCATGCCATACGTCGTCCCGTGTCCCTACGCTTTTCGTTCAA
GCATGACCGCGCCGTCTGCTTGAACGTACCAGCTTGGCCTCGACGAGAAGATACCGCGCCGTCTCGAGGTGTCCGTACGCCGCAGCCCAGTCGAGTGCGT
TCGTCGAGCCATGCGGCGAGTGATGGGCGACGAGGAAGCGCAAAATATCGGTGAACCCGCCTTTGGCCGCAAAGTCCCACGTCATGAACGAAATCTCGCC
CTTGCGATGCGTCTGCAGCCAGCGAAGCATGGGCAGATGGCCATTCCGGACGGCCATGTCGACGGCGCGCTTGGAAAAGACCAGGCGCGGCTGGTGCTCG
CAGAGGTAGACATAGCCGAGCGCCACCGCCTTGTTGCCGTCCGTCCTAGAATCGCGTCAGACGAACGATAATAGTACTATGATGCAGGGTGTGTACCAGT
CATTGAGTCGCCGGCCAGGGCTAAAGCCCGTAATCTCACCAAGCAGCGCGGGCGATGACAAGACGTGGAGGGCAGCGGCCGTCGTCATGGTGGATGCGCA
ATGGCATATCGTCGAGGCAAAGCGGACGACGCCCACAACTGCGACATCAGTCCGTGAGTAATTTGCTCGGGCGATGTCGATTGGCCCGCAACGTCCCTGC
ACCCTCTCTCCCGTGCTGCCACGCGAGCGCTTTAACCTCATCG