Description :
From Genome Similarity Track
Location :
contig_49:380421- 383202
Transcript NameFunction/comments
g9758.t1OWZ15233.1 hypothetical protein PHMEG_00011170 [Phytophthora megakarya
g9759.t1hypothetical protein

Sequence
2781 bases(100 bases per row)
CACTGTCAGCGCTCTGCAGGCTGGTGTTGTTGGCCCAGGACGACTTCGCGGGTAATGCGGCTTGGAACAGCGTTTTCGCTGCACGAACGGCTTTGCTTGA
ATCGACGCGCTGCAAAGTGGTCACACGACTTCGTTGCTTTGACCAGTACAGACCCCGACCTATGAACGTGTTCGGTTTCAATTGCATCGACCACGCAGCA
TTGACGAGTGAGTCGTCAATGACGACTGACTGACCTGCATCCGCGGTGCAAATCGCGAGGGAGCGCATCATGTTGCGTGAGTCACGAGGTTGAAGTTCCC
TTTGACGAACAATGCGCTTATATTTGAGAACTGCATGAGAGTCCTGCACGCGCAACAGAAGAAAGAGGCGTCTTACCAATCGAGGTCCAGCTCGTCAGGG
GCCTCGTCGTCGGAAGGAGACACGCGCGGACGGAACGGGTCCGGCGGGCGCTTGAAGCTGAAGGTGCGGCTGAGGAAGCTGTTGCTGCTTCGACTGCTGC
TGCTCAGACTGTCGGTTCCACTGGTGGAGCACTCGCTCGAGTCGTAGCTCGACCCAAACGGATTGGACCGCGGCCCGAGGTGTGCCTTGCCCGTGACGTT
CTTGACGCACATGGCGCAGAATAGCCGCTTCTTACTTCGCCCAGACTTGCTGAGCAGGAAGATGTGGTGCTGCTCGGAGCAGTCCCGACACACCGTCTGC
ACAAGGTGTCGTCAGCGGATGTGGCCATTGCAAGACATAGAGCGCGTGGACGTACCTGATGACAGCCCGAGCACTGCGGGTAAGAGCCCAGCTTGGGTTT
GCACGTGCAGACGTGGCAGATAGTGCTGCTTAGGCAAGACAGGCAGGAGCACAAGTTAGCTTTGCAGTGAGACAGCGAGCGGGGACACGCAAGTACCTGG
AGGGCAGCCACTGGTGGCTGTCGGCTTCGTCCATGAGAGCGCTGAATTTCTTGGCGCGGCCGCCTCGCGGGCTGTTAACGACGTTGAGCCAGGTGCTGGC
CACGCCCAGCTGAATGGCCTTCTCGGGCGCGGAGCCGAACTTGAGGATCGACCCCCAGAGGAAGATCTCCGTCTTGTTGGTGCGCTTGTGGCGGCGGTAC
AGGTAGCACGACGCGGTGTGCTGGCGCAGCATCCCGGGCGTGGCTTCGGACGGCCACTCGGGTCTTTTGATGGACTGCAGCGTGTGGTACGTGAGCTCGT
GGCCGCGCGCGTCGGTCGTGGTCCCCATCCGCTCGTAGGTGAGTGCGTCTCGGTCGTGGAGCAGCCCCCACGCACATCGCCCAGCAAACCACTTGATGCC
TGCGAACCGGAAAGGGTCGTCGGGTGTCCGACGTTCGTGGACGTTGAGCACAGAGCCGTCCTTGAGGTCGTAGCCTAGCAGCACCTTGGCCGTGCGCAGC
TCGTCGGTCGTCTCGCAGTAAAGTCCGCTCATGACGTCTTCGATCCGGCCGTCGATGAGGCCTGTGCCGACCATGACGATGATCGACTGGTTGGTCGAGC
CGGGCACGCTGTTGAAGACGCTCACCTCTTTGCGGCGCTTCACGAACGCCCAGTGCTGCGGGTCGACGTTCTTGGGGTTGAACTTGGCCCGCTCGGCCAC
CGTGTCTTGCAAAAACTTTCTCGCCGCGTGGTCGTACAGCGCGCGGTCCTCGGGCGTCAGTTTGATCTGTGGACAGCGATCGGGGCCGAACATGGCGAGT
GGCTCGCAAAATGCGTTGTGAGCATTCCAAACAGACGTGGGATAGCTGCGAACGCCGTATCTTAGTCTGGATTGTCTATCTGCGCCTGAGCGACTCGGGA
TCAACTACGACTGCCTCATCTGTGTCAGCTCATGGAGGAGCGGTACATGCACTCGACGGAGCCAACATGACATCCATCAACGTCGCTTGTCAAATGGACA
GCTGGCCTCACGCCACAGCACATGCAGTGCTGTGCAGGGCCATGCAGTTCGCCTATTTTGACGAATGTTCGTACATCGAAACTGCTATGGGGACCAAGAA
GAGCCAAAGTAAAGGAACACGAACACAAAAATTGGGAAACTGGAAGTTGTTTCAATTAGTTGGCGAGGCAACATGACAATGGACCGACGTGGTCTCGGCC
CGGCAAACACTGTCCACATGTTCAACCTTCGCTCATGCACCAAAGCCAGGCAAACGCATTCGAGTCCAATGGCGTCATCCGACTACGCTGGGCAGACATT
CCTTGTGCTTTCTGGACCTGCGCACCTGCGCTTACAGCTTGGGGCCAAGCCGATCCAGCACTGACCTCTTCTTGGCTGGGGTCTCGCCCGAAGCCTTGCC
ACGGTCGTCGCTTTTCTTGCGTGGGGGCCTCTTGCGGTCATTGCCACCTCCTTTGCCATCGGCCTCCGCCTCGATCCGCCGCTTGTCGTCATCACCGCCG
CGACGGCGGTTGCGGCCTCCGCGCGAGCCGCGAGACGAACCCGATGTCGCTGTCACTACACGACCGCCACCACCGGAACCTTTTTCGCCGCGACGCTCGC
GCTCCTTCTCCACACTTCGACGTCGTTTCCGATCACCTCCAGTGGCGGCGCCCTCGTCCGCAGCATCGCGACCGCGCTTTCCATTGCGGTCATCGTCGCA
GCGTCACGACTTCGCTTTCCATCGCGCTCCTTGCGGCCATCGTGCAGCATCGCGACCTCGCTTTTCATCGCGCTCTTTGCGGCCATCGTCCGCAGCATCG
CGCCCGCGCTTTCCGTCCGCGGCATCGCGACTGCGCTTTCCATCACGCTCTTTGCGGTCGCGAGGACGATCGCGTTCGCGC