Description :
From Genome Similarity Track
Location :
Scaffold_193:38040- 39524
Transcript NameFunction/comments
Sapdi_VS20SDRG_17077hypothetical protein

Sequence
128 bases(100 bases per row)
TCTTGAAGACCGCCGGCGAGTCGCGCAGGCTGTCGCGGAGGAGCTTGGCCGTGCCAAGAGCCACCGATGGGCTGCTCACGAGCAAAAAGTCCTGGCTACG
GGGCTCGGTCGACTCGGGAATCTTGTCG