Description :
From Genome Similarity Track
Location :
contig_49:380386- 383167
Transcript NameFunction/comments
g10221.t1OWZ15233.1 hypothetical protein PHMEG_00011170 [Phytophthora megakarya
g10222.t1hypothetical protein

Sequence
2781 bases(100 bases per row)
GCGCTCTGCAGGCTGGTGTTGTTGGCCCAGGACGACTTCGCGGGCAATGCGGCTTGGAACAGCGTTTTCGCTGCACGAACGGCTTTGCTTGAATCGACGC
GCTCAAAAGTGGTCACACGACTTCGTTGCTTTGACCAGTACAGACCCCGACCTATGAACGTGTTCGGTTTCAATTGCATCGACCACGCAGCATTGACGAG
TGAGTCGTCAATGACGACTGACTGACCTGCATCCGCGGTGCAAATCGCGAGGGAGCGCATCATGTTGCGTGAGTCACGAGGTTGAAGTTCCCTTTGACGA
ACAATGCGCTTATATTTGAGAACTGCATGAGAGTCCTGCACGCGCAACAGAACAAAGAGGCGTCCTACCAATCGAGGTCCAGCTCATCAGGGGCCTCGTC
GTCGGAAGGAGACACGCGCGGACGGAACGGGTCCGGCGGGCGCTTGAAGCTGAAGGTGCGGCTGAGGAAGCTGTTGCTGCTTCGACTGCTGCTGCTCAGA
CTGTCGGTTCCACTGGTGGAGCACTCGCTCGAGTCGTAGCTCGACCCAAACGGATTGGACCGCGGCCCGAGGTGTGCCTTGCCCGTGACGTTCTTGACGC
ACATGGCGCAGAATAGCCGCTTCTTACTTCGCCCAGACTTGCTGAGCAGGAAGATGTGGTGCTGCTCGGAGCAGTCCCGACACACCGTCTGCACAAGGTG
TCGTCAGCGGATGTGGCCATTGCAAGACATAGAGCGCGTGGACGTACCTGATGACAGCCCGAGCACTGCGGGTAAGAGCCCAGCTTGGGTTTGCACGTGC
AGACGTGGCAGATAGTGCTGCTTAGGCAAGACAGGCAGGAGCACAAGTTAGCTTTGCAGTGAGACAGCGAGCGGGGACACGCAAGTACCTGGAGGGCAGC
CACTGGTGGCTGTCGGCTTCGTCCATGAGAGCGCTGAATTTCTTGGCGCGGCCGCCTCGCGGGCTGTTAACGACGTTGAGCCAGGTGCTGGCCACGCCCA
GCTGAATGGCCTTCTCGGGCGCGGAGCCGAACTTGAGGATCGACCCCCAGAGGAAGATCTCCGTCTTGTTGGTGCGCTTGTGGCGGCGGTACAGGTAGCA
CGACGCGGTGTGCTGGCGCAGCATCCCGGGCGTGGCTTCGGACGGCCACTCGGGTCTTTTGATGGACTGCAGCGTGTGGTACGTGAGCTCGTGGCCGCGC
GCGTCGGTCGTGGTCCCCATCCGCTCGTAGGTGAGTGCGTCTCGGTCGTGGAGCAGCCCCCACGCACATCGCCCAGCAAACCACTTGATGCCTGCGAACC
GGAAAGGGTCGTCGGGTGTCCGACGTTCGTGGACGTTGAGCACAGAGCCGTCCTTGAGGTCGTAGCCTAGCAGCACCTTGGCCGTGCGCAGCTCGTCGGT
CGTCTCGCAGTAAAGTCCGCTCATGACGTCTTCGATCCGGCCGTCGATGAGGCCTGTGCCGACCATGACGATGATCGACTGGTTGGTCGAGCCGGGCACG
CTGTTGAAGACGCTCACCTCTTTGCGGCGCTTCACGAACGCCCAGTGCTGCGGGTCGACGTTCTTGGGGTTGAACTTGGCCCGCTCGGCCACCGTGTCTT
GCAAAAACTTTCTCGCCGCGTGGTCGTACAGCGCGCGGTCCTCGGGCGTCAGTTTGATCTGTGGACAGCGATCGGGGCCGAACATGGCGAGTGGCTCGCA
AAATGCGTTGTGAGCATTCCAAACAGACGTGGGATAGCTGCGAACGCCGTATCTTAGTCTGGATTGTCTATCTGCGCCTGAGCGACTCGGGATCAACTAC
GACTGCCTCATCTGTGTCAGCTCATGGAGGAGCGGTACATGCACTCGACGGAGCCAACATGACATCCATCAACGTCGCTTGTCAAATGGACAGCTGGCCT
CACGCCACAGCACATGCAGTGCTGTGCAGGGCCATGCAGTTCGCCTATTTTGACGAATGTTCGTACATCGAAACTGCTATGGGGACCAAGAAGCGCCAAA
GTAAAGGAACACGAACACAAAAATTGGGAAACTGGAAGTTGTTTCAATTAGTTGGCGAGGCAACATGACAATGGACCGACGTGGTCTCGGCCCGGCAAAC
ACTGTCCACATGTTCAACCTTCGCTCATGCACCAAAGCCAGGCAAACGCATTCGAGTCCAATGGCGTCATCCGACTACGCTGGGCAGACATTCCTTGTGC
TTTCTGGACCTGCGCACCTGCGCTTACAGCTTGGGGCCAAGCCGATCCAGCACTGACCTCTTCTTGGCTGGGGTCTCGCCCGAAGCCTTGCCACGGTCGT
CGCTTTTCTTGCGTGGGGGCCTCTTGCGGTCGTTGCCACCTCCTTTGCCATCGGCCTCCGCCTCGATCCGCCGCTTGTCGTCATCACCGCCGCGACGGCG
GTTGCGGCCTCCTCGCGAGCCGCGAGACGAACCCGATGTCGCTGTCACTACACGACCGCCACCACCGGAACCTTTTTCGCCGCGACGCTCGCGCTCCTTC
TCCACACTTCGACGTCGTTTCCGATCACCTCCAGTGGCGGCGCCCTCGTCCGCAGCATCGCGACCGCGCTTTCCATTGCGGTCATCGTCGCAGCGTCACG
ACTTCGCTTTCCATCGCGCTCCTTGCGGCCATCGTGCAGCATCGCGACCTCGCTTTTCATCGCGCTCTTTGCGGCCATCGTCCGCAGCATCGCGCCCGCG
CTTTCCGTCCGCGGCATCGCGACTGCGCTTTCCATCACGCTCTTTGCGGTCGCGAGGACGATCGCGTTCGCGCTCATTCTT