Description :
From Genome Similarity Track
Location :
Scaffold_31:380382- 400410
Transcript NameFunction/comments
Phyci_191609Hypothetical protein
Phyci_221220Hypothetical protein
Phyci_6186Hypothetical protein
Phyci_221492Hypothetical protein
Phyci_65076Hypothetical protein
Phyci_221567Hypothetical protein
Phyci_65077Hypothetical protein
Phyci_188792Hypothetical protein
Phyci_221255Hypothetical protein
Phyci_79873Hypothetical protein
Phyci_221473Hypothetical protein

Sequence
20028 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCCACTCAGTTATGATGCACGGTGTACTGTATATACAGCGTACAGTAGAAGCAAATCCAACTCCCGTTTACGAACG
AGATGGTATCTGATTTCTTGTACTATATATTTATATATAATACGCTTGCACAAGTTTCGAAGTCCATGAGAAATCGAAAGTAACACTGTCATCGAATAAG
GTTCGGCGTAAGCCAAATAAATAGTACAATAATCTACAAAACCCCAAGCTATACGCTGAAAAACCGTATCATACACGTATACAATAATCGACGAGATTTT
CTACAAGACAACCTCGCATCCTACCTTAGTATGCATTCTCCACGGTTTTTGAAAACACGAAATGCGGGAAAGAGCTTTCTTTCTGGCTCGATAGTAAATA
GAGTAATTAAAATAACTTGTACTATATATTGTACTCGATGGAAGTCATTGGACCAGAAAGTAGGCTGGCAAATCTATATCTAGAACATCAAAAACCTCTA
GCAACACtgtgacggggccaaacgagcaccttgcacagaggaattgtgctatcgagagtatacaaaatctcagtgaacggtagctcacgtgtccctggcc
taaggggactgattgatcagaagtacggtagatctaagactgaatgtattcataggtcagtacagatttggcctgcatacaaatccgaagttccctatag
tttatcctatataaaatgtatcggttggctctcaaagcctattgtgtcactactcaggggagtgacctttttgtagccatcactgaatagtgtcagggtc
acaattccatgcaaccccattacaGACACGATGCAATTCCACGTTCAGAATCCGGAAATGTGACTGAAACAGGTCAAGTTGCAGCCGTTTAGGCGCTACG
AGTACTTAAAAAGAGTGTCTCAATGTTCAGCGCCGCTTCTAATTGGGTGTGAGTTTAAAACATTAAAACATGGGAGTTATTCAGGAAAATGCAAAAATCA
TCATGCGAATTGCAACAAGGTCAACCGAATGAGACATGACACTATCCGTTTATACAGGTAGTTTATTTTTCAGTAACACTGCTTCACGCTCTCTCTACGT
ACGTATTTTCATTATCCTGGGTGTGTCGGTTCGCGTTGATCCAGTTTTGTGTCCAGCTCGTCCAGCACCTTTTCAACCACGTCACTCCCGTTATGAAGTG
AGTTTTGAGCAATTCTCCCCGAAATCGTAGCTCATATCAACTCGATCGGCTGGAGTTCGGATGGTACGGTTGGGTGTAGAACACATAATGCCCGTGTCCT
GCCGCTATCAATTGTGTCTTCGGCTTCGACTTTTCCTTGAGCAGTTTAATCCGCTGCATTAACTGCTTTTTCGTTTCGTTTACACTGTAGTGCACACCTG
ATTTCAAAACATATTTTATTAAGTGTTGAGACTAAACAAATTGTAGTGCCTTTGCGAGTGAGCCAGGAATGCATTTTAGATCGGCTCGAGTTCATAGTTG
AACCCTTGTTTATGATGTTTTTGTGGTAGGAAGCTCCGTCCAAATGAATTCGACATGCACCGAGTTGTTGCTTCCAGTTGACACAGAGCTTCTTAAACCA
TCGGTCAAACTTCACCGTGCCGAAGTTACCATGATAGTCTACATCGTCGTCTTGGGCATTTTTATCATTTAGAGGGGCATTCCAACATTTCATAGAACAA
AACCTGCCTTCGCTCTACTTTTTCTGAACGATACATAACCTGCAGCAATAATACATGCACTACAAACAAAATATATCTAATCATTTTGCGTGAAAAATAT
TGACACCTGGTGAGACTTACCACTGACCCTTTCCGCTCTACTTTGTCTTGAAGTGCCCAGGTTTTACCAGCAACGTAATTGACGTCGCAGAATGACTCGT
CCTAGAAACCACTGTTTTCAGCGGGTTAAACTGACCGCGCCGTGGTTGACGCCGGTCGGATACCTTTTATTCTAAGTAGGCAGCTCTGAAACACACGTTT
TCAGGATCAACAGCGAAAGCATCGTGTTACTCACCACGTACTGGACTATGACGAGCCTAGAGGGCATGAGAAAAGCCTCCTCATCCCTTTTAACCGGCTT
AATCCATACTGCTCTCGCGGATGGGCACATTTCTTTGTCGTCCTTCTCAATGTCGGTCTATACATATTCTAACTATGCCGTCCTACCATCGGACGAAACT
GGAGCGCCTTATCAAAACCAAAAGCAATGTGTATTAAGAGCGTTAAAGTGCTGTTCCTTGGGTATGGGACAAACCCGCTTCGCGGGAAGTCTCACTCAGT
AGATTCTTCGTTATCAGAGCCTTGCTCATCAATAACCACTGTACCCAGTCGATCCTCCAAGTCGCAAGCGCGTAGCTCATCATACGCATCTTCGAACCAG
CCACGCTCGCGCAGGATCGTTAGCATCGCAGCCTCATCCCGCTTGATGTAGGCCCAGCCTGCGGTGGAGTCTTGGTTGTTGGCGTGAGTCCAGCAGAACG
CAGGAGGGAAAGTTGCCTTCACGTTCCGAGGCGAGCGTTGATGGTTGCCAGGGCATTGGACAGTGGGCCGCTGGTTCGTGTTGAGGTAGAGCTGAACAAG
CGGAAGCGGCATGCTTGGCGGCTTGACAGAAGATCTGGAAGTGAGCTCCGAGCAAAAAACTGAAATTCAGAATTACCCTCTGAAATTCAGAAGATCGCCT
GAAATTCAAAATTCCAGCTCGACTAGATGCGATTCCATCGGTCGCGCGATTTGATTGGTTCATAGAGGTAGTTTCGATAGCTAAATCAGATATCACGGGA
TATTAAAATGCGACTTTGTGGCTGAGCCACAATCGGACATAACAACCACAGGATCGCAAGATCGCCAACTGACCAATATTGGTTTCTCACTAGAGGCTTT
CTGCTAGCGTATCATGCGACGTATCCCTGTTGATCAATACCTATGGGCAGAGGCCCATCGCATTAGAGTGGATTGATATGCACTGTACTAAAGTGTGACG
GAACCCGAAAAACACTCAGAAAAAGGTCTGGCACACAACGTATGAAATTGTGTAGTGCACATCAAGTACATGTAGCACCATACTACGAAGATGCGTGGCA
CACCGCTATTTGCAGCAACACACAAACTCGGGCTGCTCGATACCACTAAATATCTGGGAATAGTATATGAGATCATAGGCGCATTTCAACCAATTAAAAG
AGTGCATCTTAGCTGTATTTGAATCATATCTTTGGGGTGTCTTCCTGCACACTATCAAATGCAGGCCTCACCGCAACTCGTCAATACCTCAGCCTAACGA
ACGAGCCCCCCCCCCCCCCCAAGTTTCAgtggacaaccgtccgcagcgacatggcccgcgaagacgccaaacttctcatggaggacatgaagATCGCCAT
CATCGTGAAAAGTCAGCTGGTTCCCTGCGTCGTGTGTGCCCTAACCAGGCCTCACAAGACGTGATACCAGTTGCTCAAGTGCTCCTTGGAAACATGCGTG
GCGGCAACGCCGTTTGATGACTGTCCATGGTTAGGCAAGGTTCTGACCTGCCAAGAGCTGGatcgtgtaacaatcatggaaactggcaatcacgagacac
ttgtccaagccccgcgcaaatctcagctcaccccccgactgaaggactacgggcgcgaaatggcgatccaaggactgaagccggttcgaatccgcatggg
taaggctcggcgctttgggcttgccgaggcggagatgctgaccctACGCCAGGTGCAGTGGTTCGTCAGCAACTTCACCAAGAAAAGTCTTCACCGCAAC
GACGACTACGACGACAATTTGGGCCAGATTGAGCGGTTGGTTTTTGAACTCACGACGACCAACACCCAGCCGTGTTCATTCGGTTGGGGACACGACAACA
AGGGCAAGCCAGATGTGAGGAACGGATCCGACGAGCGTCCATTTTTGGTTGAACTGACAGCCATATGTTTGATGCGTAACGCGGCTCGTGGCCCCAACAC
GTTCGTGTTTCACATGGACGGCACCTTCAAGTTGAACCAAGTGGCGTATCCTGTCATCGTTTGTGGGGTCTCAGATCGCGGTCGCACCTTCCACCTCGTG
GCGCTGTTTATTGTATCCCAGCGACTGGAATGAATCTATGTCCAAGCGCTAACCGCCTTTCGCAAGATGTTTATCACGGTAACGGAAAAGCAACTGTTGC
TCAATTACGTCATGGCCGACGCCGAGGCTATGCAACAGAACTCGGTCGGTCAAGTGTCGACTCCGACCTCGTCTACCTGATGTGCTTCTACCACATCATA
GTCAAGGTCAACGAATGACTCAAGGCCGCGCCAGACAGCTTGTGCGAACAGGTTGTTGCAGACAATTACGACCTTCACTTTACTCCCGACATGGAGGGGT
ATAAAGAACACATCAAAGCGGTACTGGCAAGGTGGTCGGGTAACGAACAGCTGAAGGTGTTTAGTACCTACTTTGACAATATCTGGGTGACGAGTGAGTT
CAACTGCTGGCAGTGCTATCACACACCGGGAGGTTATGCCACGACGAACAACCCGTGGAACTGTTTAACCGGCCAATTAAGCGAGCCTACACGCTGCGTA
CCAAGCACAAAATTGGAACGCTGATCCGACTGTTGGCGGACTGTTGTGGACACCAATCCGTGATCGCTCGTTCGTTCTAGGAAGTTCCTGAAGCCACGCA
GCAGTTAAAGACTCGCGTTAAAGCCTTCCGCCTGCGCGACTTGCATCGCGACATAACACCCAGCCGATCAAGCATCGAGTTCTTGCTCGTGTCCCATACG
GTCAATGTGATACGAATGCTGTCACAAGGATGTCATCGGGTGTAACTTCCCAAATTAGGGCGCACTCGAGAGGTGGCACTCGTTTCGGCCTAGATGGGAG
CGAACTACGCGCGAATGGAACTTGAAGGACAACCGGACGGTGGCTTGCATGTGGACGTCGTGCAGCTCACCTGTGGATGGAAGTACAACTTCAAGTTTGC
CATCTGCATCTGTGCTATTTCGCCCTATAGGTCAAGTACTACACAGGGCTGGACGGCAAGCGGACACTCGTCAATCGGTTGGTGCCTAGGAAGTGACGCA
AGGCGCGTACTAGCAGCTCTCGCGTCCCTCCTGGACGACCCCGTACCAACGGACACGCACTGAATACTGATTGAGGTTAGCCATTGTTTGGCTTTACTAT
AATAATGTCGAGTTGCACTTTCCATCCATTTTAGTGAAACTACCGAAAATATGTAACCAACAGTGCTGTCTTACTAGCTACTCACTTCTCATTTTCTCAA
ATTCCTCCAAGCGACCACAAGATGCAGGCCACCGACTCCGACCAAGCTCCCCACAACGCTTTCCAGGCTTTCTTTGATTGGTGCCGAAAGCACCTCAAAG
CGCGTGGGTGGGGCAGATTAGATGAGACAGCTGCCCGGTACTTGAGGTCATGGGGCGCCATCTGAAACGACGCGTCAAGTACCGGGGACACAATTAAGCG
GATGCTGGACGCGGCAACCCACCCGCGCATCACCAAAGCCCGCCTTGAGGAAGCTGCTCGACAGGGCGAGGACGCAGGGGAGGCTGAATGGATCTTAACG
ACTGGAATCGACCTACAACGACAGCCGACGTACCAGGTGCGCACCATTCTGGAGGATAGGCCCTGTTGAGTTCCTCACGACCTGGGAACCAACTTGGGAG
CCTGTCTCCAACGTTCCTTCCGGTGGGATCAAGAAGTTCAGGCAGCGCAAGAGGCGTAAGGCGGAGCGTGCTTACATTGAAGCCGAAGCTGCTGAAGACT
AAAGAAAAGATACACGTGTAGCAAGCCATTCATACTTACGTTTTAGTTAACTTTAAAGATGCTACACTTTAACCTTAATCACAAGCGTCATGGATGTCCC
GCGCTGAACGTGACGTAGCAATAATATGCATACGTTGGCAACAGCCCGCAGCCATCCGCTAGAACGGTACAGGGGCTAGCCCTCCAACTCGTTCCGTACG
GCTGGTGCCAACAAACGCGCAATACCGTCGATGTCCACCACGGCGCCACCATGCCCGGCCAAGTGCCCAGCCGAGGCACGCCACGCCGCAAATGTCCGCC
GTGTCCGCCGCAGATGTCCACCGTGTCCACCGCAGATGTCCGCTGGTGACCGTCGTGTCCGTTGCAGCGCCGCCTTGCTAGCCCGAGTGCGCGGCCGAGG
AACGCCGCGCCGTAGATGTTCGATGTGTGCGGCGGATTTGAGTGCTGACGAAGCCCTCACGGGGCCGCGGTGGCCGGGCCGCGGAATTGGTGGTCCTGGC
CTATCCCCCGCTGCCTCAGTCACGTCCTCAATCCTATCGGTGCGGTACCCACACATTTTGGGTGCCACCTGCATCTGGCAGTGTGTTACTCCTATTTTGT
CCTAAagtgtgatacgcagaagagtatttgcccagtagccagtaatttttgaacacaggctacgcgggtatacacaaaactacatactaccccgtactct
actccatattattacatatatcttcttataaataaaaaGAAAAAGTGTAATGGGCGATAGATATGAGAGATATAAGAGAGTGATtctaactatattctgg
tcgctcagactactgggtaataaaatgaccgaacaaacgggcaacAACCATGAGGGCACCCGAGCGATGCACTCCGTgagcggagagatactgacgggaa
tcacatcgatagaggagatacgaggagggaattgtccgtttcacacaggacaaaaGAAGAAATCACTTCTACAACTCGTCGATCTTCTCTATAAGCTATC
CTTGATTCCCTTTAACAAAGTTAGCGTTCCGCAACCAATCAAGATACCTGACGTCAGCTTGTCGGATCGTCTTCAGTGATTTGCCTGTATGGTGACCCCA
AGTCATTACGTACGAGCCGCCATCAGCGGCCTTGAACTTGCTATCGAGGAACTTAGTAATATCTGACTTCAGGTTCATCGATTTTTGATAGGTCAACCAT
CGGTAGTAGCTGGGATCAATGTCAAATACATGTTCGATACACATGGACCGGTACTTATCGAATCCGAAAATGTTTGTTGGGTTTGAAGTTTGAACCTCAG
ATTTGGATGTAGCTGTGCTCTCCGCAGCCATCGGTTCGTCACTGTCAACTTGAAACATCCCACCAGAGTGGCTCGAGTCGTTATCTCTCATGAAATAATT
ATAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCAAATATCTGCGCCCAATTAATGAATGTTTACTTTTCCGAGT
TGAGTACGAAAACTCACAGCGTTTCTACTGGGTTTATAATCAAAAAGATGCTAAATTGTATATTGAATACGTTGATCTACAGCTTAGCTGTGAGTATCAT
GAAAGTATCATCAGTCCGCGATGTAGATTCTTTTTAGGCGTCGATCTCAAGCTCGATGTCATCGAGAAGGTAGAAATCGCTGAGGCTATGGGTTATCCTC
TTTCCGAGGACAACCAGAATTTCCAATGCTGGATAAAGCCGCTAAGATGCTCGCAAGCATCTATGCTAATTCAATCAAAGTAGCTATGAGTGAGAATGGT
TGCTCTAGTGATGACAAGTTCGATTATATGGCGACTTTGCGTAATCGAGAGATTGATAACGATGGATTCAAAATATGTATCCACATTATCACGAATCTAA
TGCCAAGCCATGCTCAAAATCTGGCGCTCGCAATTGAATTGCAAGAATCTACAATCACTGATAATTCCAATGCATTGGGTATAAATGATTCAATTCTTAG
CTTGGTATGCCACGCTATCGATCCAACTAAATATCGCAAACTTGGGTCGCTTGGTCTCCCGTTTGGGACTAAAAAATGCGGCACGAGCTTTATTATTCGC
GACTACGTGATTCCAGGCCAAGGCTACTTTCTGACTAATTATAATCGATACAGCATTAGCGATGCTGACATGAGCAACTACGATATTGAGGAGGCTATTG
CATTCGTTAGAGAAGCCGATGGCGAACTAATCAAGCAGGCTCTTGGACACTTGGACAAGATTCCAGATTATGACAGCCGGGTCTTCGATTGTAATCTAAT
CAGACTACGTGAATCATGCCTTATTGCTAAGAGATACGCCCCGAACCATTGTTCGATCTGCAATCGGACTCATGATAATGATAATACGCTTAAGTTATAT
GTCAACAGCGATCAGGGATATGCAACATGGAACTGCCTCGACAATCGCGGAAAAAGCAAATGTTTATCAGGGTAGAGTAGCCTATTGGGAAGCCCGCTGA
GGAAGGCATTGCCGAGTTTGCTGTGAATAAGGCAATCAAAGAGCCTGTTAAGCCGGTAAAGCAAGTAGCAAATAAATTGAGTAAGGCGAAATCTTCAAGC
ATCGATATAGAAGATCCATTTGATTGTGATAATGAAGAATACGCGATGCAGACTACAGCTGAATCTAAGGCTAAGGGTAAATATAATGATAAAAAAGATG
GCCCAATGAGTGATTCTGATATCATTGGGGCGCTACCTGTCTGGAATATCCAGATCAGTCCCTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TTTTCTCATGCCCTCCACGCTCGTCATAGGTCACGTGGGCAATGCGTTACACCCGTCTTCGCTGCATATTTTATTCGAAGGGACAGCTTGAACAGTCCTA
TTTTGAGTTTTGATGTAGCTCCAGATCACAGGTTCAAGAGCGTCAGGATCACACGTCAGCGGTCGACCACATTGAGAAGTTTTCGGTTACTCTTATAAAC
GCGTACAGGTAATTGTTTGATATTAGATATGTCCCATCATCACCGCAATGAAGTGGTTGGTCTCGAAGTTGGTCAAGTTATCCGCGTTGAACTCCTCCAT
TACGGTCGTAACATTGCCGTCGGTGATATCAAGGCACTGCGCCACATGTTCCCGGGTTCGGTGGCTGTTGAATGCTGCTCGGAAAGCTTTAATGTCCGCG
AATTTGTAGCACCGCACTACAAATCGCTTCTGGTCTGGGGTGAGTTCCTCGCGGATCCAACCATGTTGGTGGCGTTACGGTTGAGCAGTACCAAACCATA
GTTCAGGGGCAGCCACGCGAGGTGAAGTTGGTGAAGCAGAAGCAGATTGGTGTGCATGAGTTCTGGTGTGGGCTCCAGAAGTTTCCCCAGATTCGAAAGG
TCGTCTTAGCGGTCTGTTCATCATCTGGTTCAAGCGCAGCGGCTGAACGCAACGTCTCCGCGCACAAGTTCATCTACTCCTCTGTGCTTAATCGCTTGGA
CGAAGCAAACGTGGAGAAGCTCGTGCTCATCTTCCCCAAAGCCAAGAAAATGGACCAGAACGAGATTGCTGACTTTGACGCGCTCGAAGATTTGACAGAC
GAGAGTTGCGGCGAAGAGAGCGGTTACCAAGGTAATGACTTCGAGTAGTATTAGGTTAGGCTTTGTAACACACGGTTTAATCCGACTCGGAACTTTACAG
CTTCCAAAAACACAATATTGGTCGTCACAAATCGTGTGTATGCTGCCGTCATTACTAGAAGTGTAATGTACCGCGTTTCATTCTGCAGCACGGGGTCTGC
AAGACAGTGAACACCCAAATCATTCACTCACTCGATATCGCGACCAATCTTCTCGCGGTATGTCTTGCGTCGCTGCTTCCCGAAGTGGCAGTCAGCACAG
TCACTTATTCGCCATAATGCCCTTGACCATCTTTCGATCGACCATTAGGCGGAAGTGCTATGGGGCACGTTTGAGCCCAGCGCTCATGCTACGTGTCAAT
AACGCCACTGCAGCTCGCCAAATGCTTCGTAGTATTAAAAACAATTTCAGAAACGCAGCGCGGGATATCGAAACAAGCTTGCTTTGTGTGGCCAGGGGGT
CACATTGCTGATTATATACTAAATAGTGTATGATCAGTTCGTAGTTTCAAAGTTGGTAAGTAATTGCAGTATCACTTGGTAGTGCATTCATGTACACCAC
CTTAAACACATATTAGCGTCACTCGTCGTAAGAACGTAGGGTTTCGGTTTCAAAATTTCGTGGCGAGGACCACTGGATTTTCGCATAAGACCGCTTGTCA
GAATGCAGACGCGTGAGTTCAATCTTCGCGCTCACCACTTCTCCCACTGGTGCGAGGACCAAATCGGTTGTGCAACGCTATATAATTGGTCGAAAAAAGC
GATCAAAAATATTGGCACAACAATGTAGTATAGTGGTCCACTATTGTATTTATCGAACTTGCACTAAAATGGCGCGTCAAACAGTGAATGTCAGAGGCCG
ACGGCTGGGTACAATTGAGGACGACACCCGAGTACAATCGAGGAAGACATTAGCAGGGGGTGTAACAAACAAACTTTCCCTTCGTTTTTTCTCTCTGGAG
ACTCGCAAGTCAACTGACTCATGAATCTCCCGGCAACCAGTTGACTCTACAACGCTGCCATAGCCGCAGCAAAATATGCAGACCATCGGCTTGAATCTCG
CGCCCGGACAGACTACAACAGCAGTCTTCGACGCTTCGCAGCCTTCTGTCAGAATGAAGACTACCCGATCCCGCTCAATCATCACTTTATAGAGCCGCTA
GGTTGTTGTGGCAGTCTACACCAACCAGCTTGCTACTACAAAGACAAGTCAATGGCCAGCCGAGAAACTGCGCGCTGCTCTCAGTTCGCACTACACGAAG
CGGGAGATGCTCACGAGGGGTCCCCACACGATCACTGGGTTGTCGATACTAGCCCGGACGGAACCCTGGTGCCGAGGGGTTATCCGGTCAGGTCTGCAGC
CATCACCCAGATTCTAGCAGGTCCCAGCAAATCCAAGAAGCGCGAAAGAACTACGAAGCGTGCATCACCCATGTCGCTGACGATGCTGACGAGAATGATC
ACGTTTCTGGAATCGAGCTCGGTGATCAACGAGACCATGCGATTGTGATTTTCAGCTATTTGCTCTCTTAGCTTCTACGGCATGTGTCGCGTCAATGAAG
TTCTCCAGATGAAAAAAGGAGATATCCAACTCGGGCTTCAACGCAAATCGCACAAGGTCAATGCGAGAATACGCTTCGGTTGTTTTACTATCCCAGGCCA
CGATCCACTTGCAAGCCGGACGTTCTCACTTCACCACCTTCCGAAAGAAGAACAAGCTGCTGAGCCTTCGACGTATCTTgaaaggtggtgtacgcatgca
agttcgaagctccatcacgtttggtgagacactggttacgagtttcctgtgctcacgaaagtaccacgcaacggctcaaagaaacgtaaaggttgagctg
ctactgcagtagatggaactacgttcgcgagcgttagtgtgaaatggggctcgCCTATGTTGGACAGCAATTTCACACAGGTGATCAACATCGTCACTGA
GGCTGCCGGAATCAGCCGAAACCTGCTCGGTGATGAAACTTGGTTTACGTCTCTCTGCTTTCGCCGAGGCGGCGCTCAATACCAATTTATGCTTGTACCA
GAAGAGTGCAGGTGGTCACTTAAACTCGTGAATTGGTGGGCAGGTTGGGCACCAAGTGAGAGAGCTGAAACGGTGACTAGGTATCTACTAGATGGCGTTT
TGGGCCGAGAAGAAAACATGCTGGGTGACTCGCTAGCACCCAATTCAGTCTCGTGCAGCGATACAGCTCTGGAAAGCATGCACAGCAGCGATTATGGAGA
GGCTTAAATGAATAGCGACGCTACCGAAGAGTTACAAACGACTATGAGACCACCGGACGAGCGCGAGTCCGTATCCAACATTGGTGAGCCGAAGTCGCCG
CTGGAAGGTCTCCGGTAGATAGTGAAGAACATCGCAGAAACTCAAGGGTCAACGCACGGAACGGTACTGAAAGACCCTGCTATGGTGACTGATGTCGTTG
CCACGCATCTGGCGTCTGACCTTCCTGACGCAAAATCGTGGAGAGACTCCGTCAATCAACACTGGAAAGCCAATCCTGCGTGTCACCAGTATCGTGCGGG
CGTTGATATGCTTCCACATGAGCGGAAACTCCACCGATCGCGTCTCCCCTGAACGCAAAATCATCGCCGAGTTTATTAGTGATGAGTACAACAACGAGGA
GGAGTTATTCGAGAAGGAATTCGCAGGCAATGTACAGGGAAAGATGACTTTGAACAGGATGCAAACTGTTATCCGGAGGCGGGGGCAAACTGAGGGCTAG
TCGTCCTCTATTGCACCCTCGACCTCAAGTGTACCGTCGTCGTCAATTGTATTATCATCCTTTTTTGTACCATCGTCATCAATTGTTTTGACGTCCTCAA
CTGTACTGTATACAATTAATAATAGAAAAAGCGAAAAAAAGTGTTTTTTAATGCTTGTGTTACGCACGATATACCATTCATCGCCGAAATAGCAGTCCTC
GTCTGAGTCGTCAGACTCGCTGTTGAAGTCGCTTGGATGACACTCATTAGCGCTGTTGGAGTCACTAGCTGCCCCGCTTGGATTTTCATCCTCCTGTTTC
ACATTCTTCGTACTCGATCGCAGTGTCATTGCGGTCGTTGCCGACAGTGTCTTCGTCATCACTCCCaaatagatcgactaggaacagatattggcaggca
gggcagaggaaattaatgtccatgggtcggcctaagtattgcgcgttgtatgccttcaaacagtcgtaatccagcttgtggtcacattgtgatccttcca
aaacaatcccctagataacctctttgcaggctaggcgcgtcggtggagcagggacgtgcccaacaacctcagtctcacccttttcaatatcgacaccGGT
CAGtttccgcaccttgggtcttgtgggatgcagccaatcacgcagtgccggtgaaatggttgccggcaagtctgttttcggcatatccgtatgctttcat
cttcttcaccgtcgtggtcgtcaagagatcgtaaacagatgtcgcagtcgctgacgccttcgcgAGGCTCCACATTTATTGTTCATTCTTCACTGGTTTC
AGGGACGTTTCTGGGATGGGCACATCCGGCAGAAATAGAGGAGGCGCGTTGAGATTAATTTCACTCCATTCGAAATCCGCCAAGTCGAGTAGGCTAGATT
CCACCACCTCGCTGTTACTCTTGTATGTTTACGCTGCCATCTTCAACCGCGTAATCGTTATCGTCCTCTTGTAGAAGCTGGTCGAGGTAGCTGGTCTCTT
CACTCAACACATCGATGACGCCATTCTCGGCGTGACGCGCGTCGACAGTTGGATTGTCACCTTGATTACGCCTACAGCGGTGCTATGCAGCGTCCCTTTG
TCGCCGCTTTTGGGACATGTGGCTGAGGTGCTCGACACTCTCTGTAATCGTACGGCTCCGGGACGACCTCTGGTGGCGGGCGAGGTGGCGGCGGTTGCCT
ATAATCCACTGCCAGCAGTTCTGGCAGAGCTCACGAGGAAGCTCTGGTAGACATTTACTAGGTCGCCGCAGATGACACCTCAGGTTATCGGAGAGTCCGA
AGTCATGCAGGCACATACAGTCTAGAAATACCCATCCTATGAAGACACAATAataacatcaactttagttacgtcatattaattatggtccaacacatta
aaaggctgtcgcgcgtgcgcttcgggctggtcgcaccagtagagcaaggggggcttcgcggaagattcgacaatgaCGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTACAGCATAGAAGCGGTCT
CCAGCCTCAAAATCCGTATCCCCACGACGTGGTCCGGTCAACACAGGTTGAACCTGACGTCGGTCGCCGTCAGTATGCCACAAATCTAGCCTGTCCAATT
TCAATCGGACTCCCCTACACACATAATGTTTTCATTCGTTTTGCATTCCCACGCATTGTCCTTACCTCTTCTTCTAGCTTTCGCTTATTCTTTGCTCAAT
AATCTCCACGCCTTTGACCACACGAAGCACAGTACGCATGGATTGTCCTCCTTCCTTGAGAATGGGATAACTACCAATGTACTGGTTTTCCTTTGGTTGT
AACCGGTCATGATCTCGTGAACTGACAATTCATGTTCAAGCTTCGATCGCATCCCCGCCGGAATCTGATACGCTTCCTTCAGCTCGTTGGAATTCTCCAT
CAACGTCACGGTGACCAAGGCACCGTGGTTGTCCATCATGACACAATTCGTATGACGTCTGCATTCTCCTTGAACACTTGTTCTGAGGTCCGAGTGAGAT
CGGCTGCGAATGCGGCGAACCTCTCGATGCGCTCTTGCCCGCGCTCTTGTTCCTTCGCAACGACCTTGGCCATTAGACCCTCGCCACGCTCGGCAGTGAA
AGCCTTGCCGCCACGCTGGCGCTCGTTCTCGAGAACGCGGTCAGAGCTGAGCACACAGCGGAagtatcaaatagactaccaacagctggaattggttgca
cattgccatgcgaggcactgaataagaaaagcccgatggcaatatattacgaattttgggttgtatctactatgctcatattcccaacaccaaaaggaaa
gacaagaaatccagttcacaaggcttagaatgcaaatttctcggaattgcagaggattgtaaacgttgtaggctgttggataccaCTAACAATGTTTTAG
TGATCGCTAGAAGCGTTAGATTTGATATAATCGATTCGACACAGACGATCAGTTAGCAATTAGGCAGAAATCATTTCCTAAGCGGGATAAACAACTAACT
CCCGAAGAAGTAGAGGAAATATCTGAGTGCAAGTACAAATATGGAAATGATGAATTAGAAAACGAGGGTGCTTCCAATTCGCAAAACACTGGGAGTGTGG
GAGATGCGGGAGATAATATTTCTTATGTTGACGAGAATACGTCAAATATTAGCCAGTACAGTCACTTTCAACAGTTGGAATAAATAGTTCACCAGTCTCG
ATTGTACTGAGGGAGGGCATAGATGAAACTTAAAATCTAAAGCATTTGTGTTGCCGCGCACAATGCGTAAATGGTGTCCCAGGCTCAGTGGGTATGACGT
CAACATTAAGTTCAATATTATGCGTAAAAATTAGTAGGACTCGTATTCCTATTCCTAAGTCGCTAAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNN