Description :
From Genome Similarity Track
Location :
Scaffold_9:3802523- 3806348
Sequence
3825 bases(100 bases per row)
CCCGTAGCTCCTTCACCCGTGGCGCTGGTAGCGCCTTCGTCGGCAGGGCGGCAAGCATTTCCGCGCTAGCCACATGCTCCGGCACCACGACGCCCTTCTT
GGCGCAGTCTTGGATGAACTTGAGCTTGACGTCCACGTGTTTCTCCTTGGTCGAGCTTGTTTCGCTCTGCACTTGCACGATAGCCGCTTGGTTGTCCATC
AGCATGGCCATAGGCAACTTGGTGGCGATATCCAGATCACCCAGTAGCTTCTTCAGCCCGAGAAGCTTCTCATCACCCACTGTCGCAGCGACGTACTCCG
CCTCGGTCGTCGATAGTGCCACGGAACTCTGCTTCTTGCACTGCCATGACACAGTCATTCCGTTACTTGGATGATTGCCGCACTCACAGACTTGCGGTCG
TTCTTGTCGGCTGCAAAGTTGGCGTCCGTATACGAGCGCAGTCGTAGTCGTAGCCTTTTAGCATTGCCGTCGACAGGCATATCCATCTTGCGCGATCGGG
TGCCACTCAGGTACCTGGCGATGCGCTTAGCCAGCTTCCAATCCGCCATCGTTGGTGCATGGGTCCGTCGCGTCGTACAGTGTACAGCGAACATAATGTC
AGGATGTGTGCATCTAGCAATCCACAGCAAACTCCCCACCAGTGACTAAAATTTGTCACCGTCGGCCCTGCTGACGCGGTCTCCTTTGCCGTATGCGGAA
GCAATTCTGCCAAATCTGACTCTTCTGCGTCTTCTTCTCCGATCGGTGATCGCACCGAATTTGCTTTGTCCAATCCAAACTTGGTGAGCATCTCGACGAT
TGCAGCCTCTTGGTCAAATCTGTAACCACTGAGCTCGTCGTACTGCACGCGCATACCAAGAAAATTGCTGGCAACACCGAGATCCTTGGGCTGCAGGACG
GACATGAACTGGGAAACCCTGTTCTCGTCCGTGCCAGTAACCAGCAGGTCATCCACCTACGTTCCGACGACCGTCATGCCGCCGCTGTCCGCCTGGAAGT
ACAGACACGCGTCCGTAATGCACTGGATGAACCCAAGCTTGACCACTTCGCGATGAAGAGTCTCATGCCAAAGGCGTCCTGCTTGTTTCAGACCGTAAAT
GCTTTGACCAAGAAGTAGGCCAACTTCATTCACGCTCTCAGCTCCGAGCAGCTTCAGCTCTTCCTCCGTGATAACGAGTCCGTCGGGGAGAAACAGCAAA
TCTCGATACCCTCCTCCGTTTTCGCCTTTACATACGCGTTTGGAGCGTCGCCGTGTCTAGCAGGCACCTTCCATATGATCGAAATGACGAAGATGAACTT
GACTCCAGTCATATTAATCACAGCCGCAAACACGAGAAAGAAGTTAACGCCGAACTTTTTCTCGCTGCCACAGGCGACTAGATCAAACCCGTGCCTGTTC
GTTTCTTCTTGTACTCCCACTTAGTATGCAAGCGAATGCTACCAGGCTCGAACTTGACCAGCTTCCACGTGTTATTCGCCTGTAGAGCGTGAAGTTCTTC
CTTTTCAGCTGCCACCCAAAGCGCGCTCTCTGCGCACTTCTGCGCCTGCCTGTAGCTCTTCGGTTCCGGGCCATCAGCGTGGGAATTGACATCCTTAACT
TCGGATACGGTCAAAACCTCAGGCTCAGTGTTCAGCCTCGACTCGTCCACCTCCACGTCTCCATCAGCTTCAGCACGGCGGCGCGACTTGCGGCGTGAGC
GACGAGATCTTCGTGGTGTGGAGCGTGGTGCCGGTGGCGTCGTCGTCGTGAGAGCCGAAACAGTAGGTGTCTTCACATCGGATTTCTTCTCCAACGCGCA
GATGCTCTGCACATGCCTCGTGACATTCACCTTGTTCTCCGAAGGCAGGTACACCTTTTAACCCTTTTTGGATTCGTCCTTGCCGACGACGACGCCCTCC
CACGCCCTCTTCTTCATGGCGCGCTTTCCGGGGTCACGAAACAGGGAGCACTTTGATCCAAACATGACAATGTCGCGAAGGTTTGGTGCTTCGCCAGTCA
GCACTTCGAGCGGCGGCTTCCGATCCTCGTTAGCGCGTGACGAGCTCCGGTTAAGCACGTACGTCCCGTACTCAGCCGCGTCACCCCAGAAGCTCAGCGG
CAATCCTGCACCGAGCACCATGCACCGAACTATGTTGAGAACCGTGCGATGCCGCTCCGCCTTGCCGTTTGCAGCCTGGTTGCCGACTTCTGACACCTGA
CGAGCCAATCCGTTTCTTTGCAGAAGTGATCCGCGTTTCGGTACTCTCCCCCACCGTCTGTGCAGAGAACATGCACGCGAACGTCGAACCGTTTTTCGAA
CTCGACAAGAAAGCCCTCGAACTTCTTTGCAGCCAGATTCTTCTTTTTTGCCATGAACACCTTGCAGTTGTTCGACTTGTGGTCCACGAAGTTAACCATG
TAGCGGTTACCTTGGCGGTCAAGTGACGTCATGGGGCCCTTCAGGTCACTGAAGATGACTCCTCCGACTATGTCGATCGGTGCATGTTCCCCGGCGTCCT
TAGTCGGTTGATTCGCTCGAGGCTGTTTACCCTCAGCACAAACCATGCAGTGCTTACGGTCACGATTCGATATCTTGATGCCGGATGCGAGGTCATTTGC
CATACGCTCAATGGTGTGTAATGCCAAGTGACCGAAACGTGCATGGAAGCCCATCAACGTGTCCGTGGTGACGACCGGCGAGGCTGTGACTGTACTCGTG
TCCACCACGTTCATGATCAGCTGTTCCATCTTAGCATTGTTTGTAGCTACCGATTCAAGTCTAGCCACAAAGCACGTTGTGCTTTTACGTCGACATAGAA
TACTACCTCGTTGCTTTTCATCAACGCCAACTTTCCGTTGCGCTTGGTGAGAGAGCATTTCTTCGCTATCAGCCGTCCGTATGAAAACAGGTTCTGCGCG
AGTTTTGGTGCGTAGTAGACCTCACTGAGATCCACCTCAGCCGCGACTCCGTCGACAATAGCTCTCAAAATCACCGATCCTTTCTTGACTACGTCCATCG
CTCGACCATCCGGTAACATGCAGGTGTCCTCAGCAGAGCACTACACTACGTTAGTCAGTAGCACAGGATCATTGACAAGATGTCGGCTGGCACCGCTGTC
CAGAATCCAGCTCGTAGCGTCTACGGACTTGAAGTCGTTACCGGCGGCAAGTGCGAACTTTACTGGCTGGTCCTTGTTGCTTCCAGCGGAACGATCCGGG
CAATTCTTCTTCAGGTGTCCAGCCTTCTTGCACTTGTGGCATCGCCGCGTTTCCTCTTGGGACTCAGCCACTGCGTTCACGACTTCCTTACCAAGATGCT
TTGGCGCTCGATCTTCATCGGTCATCATTTGCGCCTTAACGACCAGTTCGTTCGCTTATGGGAGAGGATCCGGTCGCGTGATGTTACACTTGGTCATCAA
GGCGTGCCTCATATCAGGATCCGCGTATTTGAGCGATGTTCTCCAGCACTAGCGCTGGTGACGAGTTCGTTGCCATCATGAGAGCATTCAAGTACAAGAA
GTGCTCATTCAACGAACGCGACGGGTCCATCTTCGCGCTAAAGAGCTTCATTCCTTGTTGCGTCGAGAGCGCCCGCTTGAACAACAAGTGCATCTGATCC
ATCACAAACCAGAGCGTCGGCTGCGGTTGCCCACCAGCGCATGATGTGCTGCTGGAAAAAGAGCTCAGCTTTACCACGTAGATGTTGGCCGAACTTGTTC
ACCTTGTAGCACTCAGGCCAGGCGTAGCCACACGCCTGCTCCGCCATCTCGATCTGCTCAATGAACAGCAGCGCCCGCTGCTCGAAGCCGCTCCCAAGTC
CCTTGTAGACCTCGCTGCCGTCGAA