Description :
From Genome Similarity Track
Location :
Scaffold_14:380215- 382809
Transcript NameFunction/comments
Hyaar_Emoy2802665conserved unknown protein
Hyaar_Emoy2802666tubulin-specific chaperone C, putative

Sequence
2594 bases(100 bases per row)
GATATGGATGCAGTGAAGGAGAAAAGAAGTAAGAAGCGCAAGCATAAGGAGGAAACCATGAAGAAACCTAGCAAACACAAGGTAAAGGACGCTGGGAAAA
AGGAAAGGCACAAGAAAAGTAAGCACGATTAGACAAACAGGCAGGATGGAGCCCGATGGCGCGATGATATACAGATGACAGGTATCCACTTGTATGTGTC
ATGTAAATACTTTTGAGAGATCGAAATCAACTGGTGAAATGTTCAGTTGCTTAACCACAGCGCTGGTCTATTGCATACACCCCTGTAGCAGCAACCAGAG
CTCATCATTCGTAAGAGACCAGTTGCCGCAACTCTGCAGGGATCCCCGGCAGCGTCTTTCTTGGGTCGCAAATGCTCCAATTCGGAGACTGCTGCGCCTT
ATGCCACTTGAAATCGTTCACTTTCGCCCAGAGCCCGGAATCCTTTTGCAACCCTAGGCGCTCAAGTTGTACCCTGAGTCCATCAAAGTGCAAGTGGTAA
GGCCCAAATTGCATCTGCTGGCAATTCTCAATTATGGGATGGCTCGAGATGCGCAAATGAAAGGTCGTAGCTGAGCTTAAGTGGACGCGCAACTGACGGC
ATGCTACAAAAAATTCGCACCCGTTGCAGTGTTCAAGCCACAAGCTTCCAAAAATTGCTCCAGTATAGAATACGCAGTTCTTCAGTGCATCACCGCGGAT
AGCAGATGTCTCCACGCATACAAGCACAACACAGTTGGTCAGATGGGAAAAGTTCAAGTCGCGGCGCTTGTCGTCTTTGTCAGTGAAGCTGTGATTGTCA
ATGACAATCACCTCGTTCTGTTTATTGGCGTGCACAAGTTCATTAAACTCCATCATTTTCTGCGTTGCCAACAACAGCTGATCGTCAACATCATCCACCG
ATACAGATGGATTGTCCCGGTCTGGTAGATCTTGTTCCTTGGCTTTAGCACTCTTTCCTGCACGAGCTCGGAACTTGAACTTATTTCGAGGTGCAAACGT
CACACGAGTGTGATCAATGATCTCCATGAGCTTCGACAAAATCAGTTGCGTATGTCGAGTATCATAGGGAGACAAATAAAGTGAGGCTGCCGTAGCTGCC
GCATCTCTCATGGCGTTCACTTCGAGCACGAGAGCATCCAGCTGTACGTCGTTAACCGGTTCACAAGGCGTTGGCTGCTGCTTCTGCTCACAGAACAGTC
CCACCTGCTTGCGCACATGCTCCTCCTGCTGCAAAAACTTTTCCCAGAACACTGTCGCCAGCTCATCGCTTGACATCTCTCGATACAACCTCAACGCGTC
GTCTGTATCTGATCCACCGTCCCTCTTCGTCCCATGCTTCTCCTTCCGTCGTTCTGCAAGCGCATGTGCTAGACTCGCTTCATGCGTCTCCAGTACGGGA
AACTCGCCCGCTGTATTAACCCTCTCAGGCCGTACAATGGCACCGTGAAGTGGCTCACAGTCAAAGTATCGCGTGCCTTGAAAAGACCCATCGCCTTTGC
CCAACGGTTTGTCCAGTCGCACGCCTATCCACCCGTCATCTGGAAGCCCATCAATTTTTCCAATGTACGCAATCTCTCCGTACCGCTTGGCGTTTCTAGT
GCGTAAGCTTTCGCCTGGTCTCGACGACAGGAGCTCACAACGCGCTCCGAGCGCCGCCATCGGCTGCTAGCAGTTGCCCGGTATGTCCCCCAACGTTGGA
CATCTTATTCGACGAATCAACGGATGGTCAAAAGTATCACCTCAATCATTCGCTCAAATAAACAAAGGAACGTAACCCTTTTCGTCTTTTTCTTCGCTTT
TTTTGCCGTACTCCTACAAAAATTCTTCGAATCTCCAAACACAAGAATACGGTTTTTATCTNNNNNNNNNNCCGGTTTGTCGTCGACGTTGACAGCTTTT
CGACGAATCAACGATGCCAAAAGTATCACCCAATCATCGCCCGATTACGAAGGACGTTACACTTTCGTCTTTCCTCGCTTTTTTGCCGTCACTCGAGATC
TCGACCTCGAACACAGAACCGTTTTACTTGTAACACAGAGAGAGAGAGAATTCAAGAATTACGAAGGAAATGAACCCAGGCGGCCAACCCCCACACGGGT
ACCCACCGCAGCAGCCGGGGTACCCTCCGCAGCAGGGATATCCCCCGCAGCAAGGATATCCCCCGCAGCAAGGATATCCGCCCCAACAAGGGTACCCGCC
TCAGCCGGGGTACCCGCCGCAACAGTGCCCGCCGCAGCAAGGATACCCTCCACAGCAGGGGTATCCACCACAGCAGGGGTATCCACCACAGCAAGGATAC
CCGCCGCAACAAGGGTACCCTCCACAGCAAGGGTATCCTCCACAACCAGGTTACCCTGTTCAGCCAGGGTACCCTGTTCATGGACACAAACACGGTCACA
TGCCCGGACACGCGTACGCTCAGCCCGCATACGTGGCGCAGCCTGGTGTGATCCTCGCTGGTGGAATGATGAAGCACGGGAAGTACAAGCATGGGAAGCA
TAAGGGGTACAAGCACAAAGGGTACAAGCACAAAGGGTTCAAGGGAAAAGGGATGAAGAAGATGGGGAAGAAGATGAAGAAGATGTTCAAGTAG