Description :
From Genome Similarity Track
Location :
Scaffold_20:380175- 381538
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007927Protein of unknown function
Pytul_DAOMBR144PYU1_G007926Similar to Kcnn1: Small conductance calcium-activated potassium channel protein 1 (Mus musculus)

Sequence
1363 bases(100 bases per row)
AGCGCGATCAACCAGCAGAAGCTGTCGTGGGAAGAAGTGGTGCGCCAGCACATCCCGGCGGGGGAAAGCGCGTCGGAATGGATCGCGATCATGAAGAAAG
ACGAGCAGCGTCTGCGCCACGCCACCGCCACAAAACAGCTTAGTAAGCCGCACAGCCGCTCGTACCGCCAGAACGCGAGTCCGCTCCCGAACGTGTACAT
GGAGGTCGAGACGTTGCTGGCGAGCATGCTGAATGAGGCCGTGCGCGCGTCACACTGCGAACACAACGCGAAGTGGCGACAGTACCATGACAACCTGGTG
TCGCAGATGACGCGCGCAGAGCTCACGAAGGTGTTCGAGCGCGACTTCAAGCAGCAGTTGCGTGAACGCGTCATGAACGACCCCGACTACCTCGCGGAGA
AAGCCAAGGGCGACGACAACCGATTCCGCAACATCACTGAAGCGCTCGCCGTTTAACTCTATTGCTCAATGAAGCGCGTTTCTTTCTTTGCGTGATGTGT
GCATGTTGCCGATACTTGTATAAAAGGGAGGGAAGTAAGGCATAGAACACACAAAACACGCCATGCGTCCACGTCTACCTGTTATCCATTATAATTTTCC
CTGTCTTCTGTTTTCGAGCGTTTGCTTCAACCCACCAAGTCGCGTGGCTTTTTCCTGAATGCGCTGCAACAACTGCGCTTTCTCACGCTCCATGCGGTCG
ATATAGTGTAGCATGACGTCCTCCATATCGGCGAGATGGTCTTCGACGCTTTGGCTCATGATCGGTCGCGCGCTGCGCAGATTCCGGCTGTCGCGCATCA
AATCGAACAGCCTGCGCTGCGCTTTCCAGATGCTCTTGTCACGAGACCACCGCCAGGCACTCTGCAGCAGCAGCACGGCGTTGCGATGCGTCTCCTTTTC
CCATCGGTCCATGTCGATCAGGTGTTTCACTTTTTGCTCCTTGGGGGAGAGCTCGAGCACACCGAAAAAGAGCGACTGGATCAGCGCCACGAGCACGAGA
CCGCCAAACATGGCGCTGGTGGTCGTGAATGCGCGGCCCAAGTACGTGACTGGAAAGTAGTCGCCAAATCCTGTAGCAGACTTGCAAATACACAATGCAA
CACACGTTAATTCCACCACCAGCAAGCCAATGTTGGAATGAACCACACTTACGAGGGTGACAGCAGTGAGCCACACGGACTTCCAGTAATTCTCGAACGA
TGCCTGAACAGGACTCTCGAGGATTCGGATGATCGCGGCCGTGAGAAACGTGTTGAGCAGTGTGAGCGGTACGAGCAGATGTAGCGGCTTGATCTTGAAC
AGCGCCTTGAAGTGGAAAAACGGACGCATCGCGTTCACATCGTTCAGTGTGCCGATAAACGCG