Description :
From Genome Similarity Track
Location :
Scaffold_66:38017- 39404
Transcript NameFunction/comments
Phyci_231025Hypothetical protein

Sequence
1387 bases(100 bases per row)
TCTTCGATTTGCTCGGCGATGATGCGAGCCACATACGCGTCGCCGACGATGTTGCATACCGTCATGAGTCGACCAAGGAACCAACTAATGGCCACTAGAT
AGCTGTAGCTCGCGGGGACTTCTTCGTGGGGGTAAATCGTGGCCCAGATAGAGTAGATCATGACGACGCTGGAATTCGGGATTGGAGCAGTCCCCATCGA
GCCCAGAACTGCGAGGAGCAAGATGAGCGTAAGCTGTAGCCAGCCTAACGGCACTTCATGCTCAGACGTGGAGGCGAGATACACCAAAGCGCACGGAAAG
TAGAGAGCTGAGCCGTTCTTGTGAAGGATGCATCCGATCGTGACTACAAACTGCAGAATACTGCGAGGCACCTCGCGAGTGGACTCGACGCAGCGTATTG
TCATTGGTAGCGTTACTAGCGATGAAGACGAACCCAACGCAAACATCGCTGCTGGAAACATCGCACGCATGAATGGAAAGGGGTTCTTCCTGATTGTCAA
CCACAGCAAGATCGGGAAGAAAACCAGTTCGAAGACTACAATGGAGAGAATGATGCCCAGTACAAGGACTCCCACATGCGTGGCGACCTGACCGAGCATA
TCCTGTCCTGAGAGCGAGCCGGCCACAAGTGACATCACCGCAATGGGGCTCCAGTCAATTGCCTTGCTGATTACTCGGAAGAAGACCTTGTTCATCTGCT
TGAGGACGTCGAGAAGCGGGCTGCTCTCACGAGAGCTCGTTTTGATTGCTGCTGCACCGAAAGTGATGGCAAAGGTGACTACACTCAGGAGCAGACCTTG
CTGGAAGCTGGAAAAAATGTTGGCTGGAATGAGTTGGTTCAAGATATCTGTGATTTGCATCGTCACAGTAGCAGCGGAGTTAGCAGTGCCGCTCGTCAGG
AGCACTCGCGTCGGGTCGTAAAACTCGAAACGAGTCGTGCTGTTCATCGTGGGCCCCGAGCACGTTGCCGTGCCGGTCGCATTGTACGTCAGGAAGCTGC
CGTTTTCGCACATGATGCTGAAAAATGCCGAAGACGTCGAGGAGGTGACGCCCTTGGTGTGTGGGTGCAGACCGCGCAAGAGCATGGCGATCGCGAGCGA
CATCATCGAGGCAAGCAGAGACAGCGCCGTGAACATGAGCGCAGTACGTGTGCCGATGATGGACACTTTGCCCAGCAGTACGATGTCAGCCACAGTCGTG
GAGAGGCTGGTGAACACCATGGGGACCACGAAACACTTGAGCACCTGGAGAAACACTTTTCCGGGTAGGTTCACGAGGATGGTGACATCGTCGGAGACGT
CCACTTTGGATAGCAGCATGCCAAGCAGCAGCCCTGCTATCGCGCCAAGTACGACTTGCGTCGTGGGCTCCCGCAGGAAGGCGCATC