Description :
From Genome Similarity Track
Location :
Scaffold_32:380079- 385798
Transcript NameFunction/comments
Phyin_T30-4PITG_14056Putative uncharacterized protein
Phyin_T30-4PITG_14057Alcohol dehydrogenase%2C putative

Sequence
5719 bases(100 bases per row)
CATCTCGATCGCCTTTGTCTGTGTCACAGTGAGATACTAGAGCAAATTCTTAAAGCCTACTGCTTTTCTAGAACCTGATCGAAAAAGTCAGAGGGTAAGC
TGGCAAGAAACGTACTTAAGTGGGAAAATATCATAAAATATCATATAGTATCTAATATTTTTCTGGTCTCCGAGTTAATATAAAAATATTATGTTAACCT
TTGCAAAATTTAGCTACTATTACTGTCTAATATCGAAAATAGTACTACTACTATCAAAAATATCATATGATATTTGGTTACCATTAGCCCCTGCGTTAAA
GATCGACTAGCTGAAGTATTACTAATCAGCGGTGAGTCCGGGACAATTGTGAGAGTTACTGAGCGGCTGCAGATTAATGGGATGCAAGATACGTACGAGA
CTATCGGTAGATAACAAGAGCAAATATCATGATTTCGCTCTATCGAGTTAAATCAGCTGCAACCATTTGCTGTTTTCGATCTCGATCGACTTTGAATGTG
TCAGTGAAATACTTTAGCCAATCCTCGTCAGTTTTAAAGCCTGCCATCACTTCTTCTATTTTAAGAACCTGACTGAAAGAGTGCTCTAGAAACATACTTA
AGTGGGAAAATCGTAAAATACCATCTATAATTTTTTAATCTCTGAGTTAGAATTCAATATAATTTTAGTTTTGTCCTAGCTAATATTGATATTTAAGAAA
GAAATAGTACTATTCCTTCAAAAATATTATATGATATTTGGCAACCTCTTGCGTCTTACACATAAAATAATGGAAAGTGACTTGTCAGTTTCTGTCAATC
AAGTACACGAGTTCTCTGGCCAACATTCCAAGACTAGATGGCGGAGAACGAATCCCGTTTTACCCTTACGAGCGTGGCCGTCGTGTGTCGCCACTTGCTC
GGGATACAAGCGCTTCCACATGTGGTACATCTCATCCAAGAGTTTACGGAGAATACATCACAACGGGCGTTGTTGGGTGTGTTGGAAGAAGGGAACTATC
ATCTATTCACCCGAGTACTTCACGCTGTGGACGAGAGTTTAAACATGATTCATCACGAGAAGCTGCGCCAGTATCGATATGCCATGCAGCTGGTTCCATG
CAAAATGACTTTGGAGGAAGGCGCGTTGGGGGCGATGCAGCAGTTATACGATCGATACTCCGGTGCTCTGGACGACGAGGCAGCCAGTTATATCGCTAAA
ACTGCAGAACTGCCAATGATGAAATGGCTGTACAAGGTTAAACCTCGACTCTTCAAGGATTTTCCAGCTTGCAAGGGTCACATTTTCATGCACGCCTCGC
TGAAGGGTCGAGGCGATGTCATTCGCTGGTTGGTGAAGCTTTTTCCTGATGCTGTGTGGAGTCTAGTCAACGCGGCTCGAGGTGGCCATCTGAAAGTACT
GAAGTGGCTGACGAAACGTACAAACTGGGATGATAATTCGGTAAGCGATGCATTGCAGAGCGCAATCGAGGAAGATCACCTAGACACCGCCAAATTTCTT
TTACAGTCTAAACCTGGCAGAGATCAAGAAGTCTCCGAATATGAGACTTGAATCACTCGAATGAGCCATGATCCGATCGAAGTTTGGAGTCACAAAGCTT
TGTGTTGTATTACTGCGAAGACAAGGAAGACTCGATTGCTGCAGTTGCTGCACACTCCACCATCCCGAGTTTTTCTCCAATGAGTTGATGGCTGTTGCAG
CCGAGAATGGAAATCTGGAGATAATAAAATTTCTTCATCAAAATTGTCGACACGGATGCACCTCGAGGGCAATGAATTCAGCCGCAAAAATGGGCCATCT
AGAAGTTGTGCAGTGGCTACACAACAACAGAACAGAAGGATGCACTAGTGCTGCAATGGACGAAGCTGCTAGAAATGGCCACTTGGATGTGTTAGAGTGG
CTCCACGCTAATCGAAGCGAAGGATGCACGCCACAAGCGATGAAAAACGCAGGAAGGTATGGGCGCATGGGGATTATGAGATGGTTGCACGAAATATTTG
ATCTTAAGCTACCAACAAACTACGCGGACAGACTAGCGTCTCTTGGTTGCTTGGAACTTTTATCATGGTTACACTTTAGCGGCAAAGGGCAGTGGTCTAA
AAGCACGATGGACGCAGCAGCAGGTCGTGGACATCTCGACGTCGTCAAGTTTTTGCATGAGAATCGACATGATGGTTGTACCAAAGAGGCCATGAATACG
GCAGCACGGGAAAATCACCTGGAAGTGGTCAAGTTTCTGCATGGAAACAGAAGGGAAGGGTGCACGAAAGCAGCGATGAACGCAGCAGCGAAAAATGGCC
ACTTGGAAATGGTGAAATGGCTTGTTGAGAATCGACGTGAGGGCTGTACGAAAAGTGCACTGCCTGCAGCAGCTCTTGGCGGCCATCTGAAGATCATGAA
GCTGCTGCATGCGAACTACAACTTTGACTGGTCCCATAAGGCGATCGACGACGCGTCGTCGGCAGGACACACGGAGGTCGTGAAATGGTTGTATTATCGC
TTAAACCAGACACTTCACAGTAAGTTCGCTGTTTCTGCTGCTCGCCACGATAACCTCGGCGTTTTGGAATTTATTGACACGGTATCAGATTTTGCGGCCA
ATACGTCCGTCTACTATGTTGGATGCGGAAATGGGAATCCCGAGGTGGCGAAGTGGTATATTGACCACCACGGAAACCCCCGCAAGCGCAAGCGGTAGGG
GCGTCCCAAGGAGGGAGGTTTACTCTCGACGGCCGGATTTGATAACGCTAATTCATAAAACGAAAATTGAATGGGTTGTGGTACATCCGATTAATCACAT
GATCGCTGTGATTTTTCTATGCAAATTAACCGGACGACCCTCGAGGGGGACTTCTGTACGTAAAAATACTCATCATTCACGATGCTTATTCTAGCTGAAA
TCACCGTAAAGGAGCACAACAACCTTAAAATTGACAAAGCGCTCAGCGGCAAAAACCTGGAAAATACTGAGCAACAAGAACATGAAGAAGAAGCAAATTA
TCCACAAAACCCTCAACAGTAAGACTCAGCTGTCCCAGTTTTAAACGTTTTAAAGTGTTTATCGGTCCGAACGTGGCCGACTTGTTCCAGACTGCGGTCT
CGTTTTATTCTTGATCTTGTTCTCACAGAGCCGTGTTTCATGGAGAAGCTCTGGATTATACTACGGTGTGTAGGGCGGTTGTCTCGCCACTTTGGGAGAA
GGTGGTGCTTGCATAAAAGAAATGGCTGCGCAAATACAATACTGCTCGTTAAAAAAAGTTTCTGAAGAATAAATCAGAAATATAAGAAAAACTGTTGATT
TTTTTCAGCTACAAGCGAGGTTGTTATTCCGACGATGGTTCCAATCCAATGCTACCGAAGAATAGAAAAAGAATGAGCGCAGTAATGGCTGTGAGGATGG
TGCCCTTGTAGAGTGCTGCCGCGTTCGGGTTTCTGTCAATAATCGTAGCAACTCTGCGCTTGATGTTGCTGTTTGTAAGCGAGATTCTTACTACTGAGAG
CTTTGTGGAGATTTTTGTCACTGAGCATCTTGTTCAAGTTCTTGTTGCTTAGAATTTTATCAGCTTCTTGTCGCTGAGGGTTTTGTCGATGTTCTTGTTA
CTGACTGCTTGTGCGATGTTCTTCTCGTTGACGGCTGATAGATTCGGTGTAAAGAGGTTATCGACTCTCGACGCGATTCCCCTCTCTTCGGTGTATTTTA
TCTCCGTTCGAGTATCGACAACCCTGAGATTGTGCGTGTTATCATCGCCAATAACACTTTTGCTGCGCTCAATCTCTTGTTCATGGTTGGCGCTTGCTAT
CTTTGCGCAACATACCGCTAGAATACAAAACAGCAACGCCAGAAAACTAGTTGAGCGCATTCCAATTATTAACATCGATCTTCAGGTCCTGCGTGGTAAT
CGAAATGAGAAGGTTTGAGCTAATTTTGCGTAGAGAAATTCATACCACGAGAGTGTTGTCGATCTGTCGAAGTGTATGTTGAGTACTGGGCCATTATACT
AATATTAAATTTAAACCATCTGCGAACCAGAAGTGATCTGTTCGAGACAATCTAACGAACACTGCACTGTACAGTCTGTAGCTAGGATGGTAGCAACACA
TTACTACTTGTTGAGCATGTAGTACTTTGTTTTTAGCAGCTACTGTAGTAGTAAGGGTAGTAATTACTCATACAATACATGGTACTACAGTAGTTGGAGC
CTGACTTGCTACTTTTCAAAACTTTATTGTAGAAATCGAACATTCGTGTTTTGGAAAATAAAAAAGTCTGATAATAGAATGCACTACCTCGTTTGTGGCC
CACATTGATATAGTACACCAGTGAGATTATCTACTCGAGCTTGACGACCAGCTTGCCGATGTTCTTGCGCGCATACATGTAGTCAATCGCCTCTGGGATG
CTCTCCAGACCGCGGAACTCGGTCGAGTCCACTCCTGGGCTCAGCTTGCCCTCTGCCATCAGCTTGAGCAGCCGCTCGATGTGCGACGGGATGAACTTGT
CGTGGTTGTGCAGAAGGAAGCCACGCACACTCGCCGACTTCATGAGCAGCTTCGGGTTCAGCTGATTCACCAGCATCGGCTCGGCCGACTTGTCGCCGTG
GTAGCCCGAGATGTAGCCAAACACAATCACTCTTGCGTGCACCGCCAAGTTGTCGGTCACAGCCTTGAACATATCGCCACCGACGGTCTCAAACACGAGG
TCGATGCCCTTCGGATACTCCTTCTTAAGCACTGCACCCACGTCTTCCTTCGTGTAGTTAATGACACGGTCACAGCCCAATTTCTTCAGGTGACCCGCCT
TCTCGTCCGAGCTGCACGTGCCGATCACGTGGTTACCCGCGAGTTTGGCCAACTGCACGACGTACTGCCCGGTGCCTCCAGCAGCAGCCGATACAAACAC
CGTCTCATTCGTTTTCATCTCTCCGATCTGCTCCAAGGCGATAGACGCCGAGATGCCGCCCACCGTCATGGTCACTACAGCGGGGGACAGTTTCGGTGTC
TTGATGAGGTTAGCCGAGGGCACTTCCACGTACTCGGCGAAAGCTCCGAACTTCTGATACGCCACGGCGTCACCTACTTTGACGTTGGTGACTCCATCGC
CAATAGCGTGCACGATGCCTGCAGCCTCGAGACCGCAGCCGAACGGAGGCGGCAGTGCACCCGTGTAGGCGCCGGCAGTTAAGTTGATATCCGTGGCGTT
GATACCCAAAAACTGGTTCTTAACAACGACGTTGCTGGCTGAAGGGGTGGGGATTTCAGGGACGTCGACGATCTTGGTGGCAGCACGGAAGTCCTTGGAC
TTGGTGTGCACTTGGACAGACTTAAAGGACGGCATGGTTGCTAGGTGGGAAGTGAGCTCTTGCACTCAGATTGTAGAATGACGTCAGTGAAGAGGTGCGA
CCAAATCGAGAAAAAAGTGTTGATGAAACAAAATGCTGGACTAAAAATGAGACAAACGGGTCGGAATGAAAACCCGGGTTTGTTTGATTGGGAGTTTGTA
AGTGGACGAGAACAGCTGGTTTTGTGATTTGTTAATCGGCATGTCGGACGTCAACACTCCGATTAAAAAGTTGGTGAAAGAGCTCAGCGTACGATGACAA
GGGAATCGCATGTTCTCATCGTACGCTGAGTCTTAAAGGGATTTTGTTGCTGACTCGTATTATAGTAGCTGTAGTCACGGTAGGGCTGACGAGACTCCAG
GCTGGAGTCCGCTGATTGG