Description :
From Genome Similarity Track
Location :
Scaffold_16:380079- 417408
Transcript NameFunction/comments
Phyra_76172PREDICTED: uncharacterized protein C5orf35-like
Phyra_76173sorting and assembly machinery component 50 putativ
Phyra_76174Hypothetical protein
Phyra_76175PREDICTED: LOW QUALITY PROTEIN: pericentrin-like
Phyra_71397putative potassium antiporter CHAC-1
Phyra_76177Hypothetical protein
Phyra_76178Hypothetical protein
Phyra_71398GTP-binding protein TypA/BipA, putative
Phyra_76180callose synthase, putative
Phyra_76181Hypothetical protein
Phyra_76182Hypothetical protein
Phyra_76183Hypothetical protein

Sequence
37329 bases(100 bases per row)
ATTTCCGTCGGGATCGCTGGCAGCAGTTGCGTGCTTGCTGATGCACAGAATGCTGCGCTGTATGTGACGATTTTGATTGTGGAGATTTTCGCTAGTGCGC
TGGGCATCTTCGGTGTCATTGTCGGCATTATCCTTTCCAACAACGCGGAGTTCCCTAAGTAAGCAAAACTATGAGGACGAGGAGACCGTGTTTAAGCACA
AGGCCATACACGCTACACTATCTCGGCTATCCTGATGCGATTTGTGTGTGATTGCACCTAGCTCAAATTTACCATTTAACCACATCAATGCATTTCCTTT
CTTCTCATTCTACTAGGCTACTAGAATCATTCTAGTAGCCTATGGCAGAAAACGTCTCAATCGAAGCCAAGCCTTATTTCCACATTGCGCGGTCGCTATC
AACGTCGACAGGTGCATACCACTTGGGCAGTGAGCGATCGGGGTTGTATCTGGTTCACCAATTCTCAGTGTGAGTACAGTACTGTGTTGCAGCAGCGGTA
GTTGAGATTGGAGGATAGACGTACCGATAGTTGAGAAAGAGTTCTTCTTCATCTACAATGTCAGCCGTTGCGACGAATGCTAGGCCCTGATTTCAACACA
GGAGGTAATGTCGTTAATTTATAATGGACAGGAGCGAGCTTTTTTCTGAAAGGAACTTACATGCACGATTGCACGTTTGCCAAACATGGAGAGGCGTGAA
GGCTCTTTCACAAAACTGTTTGGAATAAGCTCGTCGAATTCCTTTGTCGTGAATGGTTCTGCAAAAGACAGAGTACCGTGGTTAGCACCCACAAGTCACG
AAAGGAGCTACCGGTAACAAAGCTAATGAAGCATTATCAAACCTTCGAGTGGGAACTCAAAACCAAAAGCAAGCACATTAGGAGGAGTTCCGCTGGGAGG
GTGGTTAATCTTGTGCGCCACAGCAAGAGGATTGCTCGGCTTGGAGGCTGGATGGACATTCAAATTCTGTCAGTTGTGCTCTGGGGGAAGAGAACGGATC
CACTGTTGCAATATAAGCACTCTGTCACGACTGGCACGCACATTCGTTCTTGGCGTCAATAATCACACTATCGAAGCGGGCTCGAGCGAATGGGTTGTTT
GACAACTCGCTCAGGTATTGTTTCTAACACAAGGGAAAAGTTAGATTTAAAGCACCCATGGTCCAGCTAATATCCCAGCAGCTTCACCTTTTTGTAGTGC
TCAGGTAAGTAAACAATGCCCGGGTACAGTGCCTGTTACACCCAAGCCGTGCATAGCATAAGATAACACAGCACAACATCAAAAGTGTAGCTAACCAGTA
GCAATTTCGTACCACTAGGGACCCGATGGAAGCAGCACCGCGAAGTTTAACGCCTTCCCCCGCATCAGGAACGCTTGATTCTTCCACGTTCAAAGTGAAT
CCGAACAGCTTCTGGAAGTCGCCAGTGATTCCAAGCTAGGCCGGTAACACGCGGGTGAGCCAACTCATCATCCCAGCAAAGGGTTATTGACACCTTTCGC
ACCTTCTCGCCCACTTCAGTGTTGCGCTCGAAACCTGACAACGACATCTTAGGCGCGTTCTTCTCCGACTCCTTAGGCATCCGCAGCACAGCGTTAAAGC
AGCTCTGGACCTGTTGACAATAGATATAGCCTGCGATTCAGCACAGATTTTGCTGCAGTCCAGCTACGTTATCTACACCCACGCACCTGCTTGCTGAGTT
CATCTTGCACATACTGCTTCTGCTGTTCGAACTTCTTCTTGCCTACGATCTCCACGGCTTGGTCGAACAGTTCCCCATGCTCTCTGCACAGAGCACACGA
GATTAATATAATCCAAGTCATCTGTGCACAATTGCAGCATTAGAGCGCAACTCACTTGTCCGCATTCTGCGGGTCCAGCTTCAAGCTCCGGAAGCAGCTC
AGCACCGCGGCCACGCCCACGTCCGCCTCCTCCTGCTCATAACAACGTTAATTAAAACCAACAGTTCGTCCCTGTAATGCTCTTAACACACTACAACGCG
ATGCAACGCACCTGGAAGCGCCGCGCCGGCGTGGTGCCCGCGATTCGGAGCTGCAGTCGGCGCCACACGCTCGTCATTTCGTTTTTGCACATACTATGGC
GTATGCGAGGCTTAGGCTATACAATGGGCTGGCCAAAAGTGCGGCGCAAAATCACACCTGAAAATTGGCTAGAGGGAGTGATGGCGAGCACCAACAGCAG
CGAGACGCCCAAGCCTGCGGCCGAGGACCCACCTCACCCGTGGGGCCCGCGCATGCGTATCGGCAAGGTCTTCCTCAAGGGCAACGATCGCACCAAGTAC
GCGCGACTCGTGATTGATGATGGTGGTATCCAATCAAGCCTGACAATTGGGTTCTGTTTCGTGTGAGTACAGGCCGGAGGTATTCGAGAACGAACTCCAG
GTACAACTAAGTCATGCAACAGTTGATAGTATATATATCTACTGGTGCGAGGATCTGACAGACACGGCGTACTCAATCTGTAGGCGGCGTACAGCGCCGA
ACGGATCGGCCAGTTGGTGCACAAGCTGGAGGAGGCCACGGAGGAGTTCAGGGCGCTCGACATTTTCGAGTCCATCAACATTGAGCTGGACAAGGGTGAG
GACGTGTATTCAGGGTGGCTGCGGATTGACGAGCTAGATTTTGACGTGGTGGTTTGATGCGGTTGCTGCAATCACAGCGAGCTCTGGCCAGCTCGATGAG
ACGGACCTGACGATCACGGTGAAGGAGAAGGGCTGGCGATCTCTGCACGTGGGCGCAACCACCGACGGCAACGACGAAGCAGGAGTACGGTGCATTTAAT
TAAAGAATCGGCGCGTAGAGATGGACTGCTAACAGATGATGCTCTTTGTTTGCAGGAATCTTCGCTCACGTTGTCGAATGCCCTCGGTGAAGCAGAGAAG
ATCACGCTTAGTGCCACTTATGCGCGATCGGGCAGTAACACCCAGCGCGCGACGTTCAAGAAGCCGCGCTTTTTTGGTCTACCGCTGTACCTGAGCGCCG
TTGGCACCAACGAGCTCCACGTCAGTAAAATTGCTGTGCTACTGGATTTGTTGCAGACTATGTCGTCTGATTTTACGGGGTATTGCTTTTTCAGAACCAA
GAGTGGCTGAGCTCGTACAACGAGAAGATTCGTGCTGGTAGCATTTCGATCAGCGACTATGAAGGTGTGCACGACCTGTCGTTGAATGTGGGTTGGCGCG
ACCTGCTTCCGCGCCGAGACTCCAAGATTCCGACTGCGTACCGTGCGTCACCGAGTATCCTGGCGGAAGCAATGCCGTCCACGAAGACCAGTGTGAAATA
TGTGTTCACGGACGACAAACGGAACAACGTTGTGTATCCGACAGCTGGAGGCCTCTTCAAGTACACGTACGTGACTTGGCAACAGATCCATTGCACTTGC
AGCAAAGGTTCAGCTGATCTAACAAGTTGTCTGCTTGGTGCTTCTTAGTACGGAGATTGCTGGTCTTGTGGGCGATGTGAAGTTCGTGAAGGCTGAGGTG
GAGGGTCAGAAGCACGTTGCGCTGGGCCCTGTTCTCAATGGATTCCCGATCCTTAACTTCAGCCTTTCGTACCACTTGGGAACGGTGAAGTCGTATGGTA
GTGAGCAGAACCGGCCAGCACGCATCAGTGACCGCTTTTTCCTGGGTGGCCCCATGAATGTGCGTGGCTTCAACCACAAGGGCATTGGTCCTCGGGCTTC
TCCTCTTGATGGCGGGGTTGCGCAAGGTGATGCGCTTGGTGGCGACGTGAGCTACAACGGAACTGCAAGCCTCGGCTTCCCTGTTCCTTTGCCGCTCTTT
GTTGTAAGTCTGTCTTGCATGAACCAATAACTTTGTCCGTCTAATTCACACTATCTTCGTGTGCTTTGATGCTCAGGCGCTGGGTCTCCGCGGACAGTTT
TTTGCTAACGCTGGCAATCTAACGACGTGGGACCGCCTGCTTGATGAGAAGAAGTGGCTGAAGAACCTTACGGACGACACGCGTGTTTCCGTGGGCATGG
GTCTTGTATGGGGAACCCGCATCGGCCGCCTCGAGGCCAACTACTCGTGGATTCTCAAGGCGCACGCTCATGTAAGCTCTCGCTTTTCTCTCTCTGGCAA
TTTGATGTTGACTAATTTTCGCTACTGTCATGCAGGATAACATCAAGCGCGCCCAGCTTGGTCTCGGCATGACCTTTTGCTAACCGTAGAGAGTAAAGGC
AAAGTAAGGAGGGAGGGTTGACGAAATACACTGGCAGCATCAGCTCCCAATCCACTACATGTAGTCGCTACCATGACGAATTATTAATAAGGGGCTAGTT
ACGATTGACCCCTAATTCGACTCTCTTTTAGACTGGATGATGCTCCAAGGAACCTACTGACCAGAACCCAGGCCACTCACTGAGATCTGCCGCATCGGGA
AGAGAAGGTCTCCACTTCCAGTCTCTTCATCTCTCAAGCAGCAGCGCCATGTACTCGGGCAACGCCGCGCGCATCTACAACCCGCAGCCGGATCCGCTGG
AGCGCGGGCCGCCCAAACGCGTGCTGCGCGAAGAGCAGCACATCGGCGAGATGGTGGCGGCCTCCAAGAAGCGCGTGACGTGGCGGTTCACGCTGGGCGA
CTCGGACCGCACGCACGAGGTGGTGCTGGTCCACTCAGTCATGAGCTACAAGAAGGTGCGACTTCTGTGGCTGGTTAGGCGCTACTTGAAGTGGATGACT
GATGGGGAAGCGCTTTGGTGGTGCAGGTGGTGCAGTATGACGGCCGACAGATGCATTTCTCGTCCACGGTGAGGAGATAATTTTTGATCATGTTGAAGAA
GTTGGGATTTGGTTTTTATCGTGATGTGTGGTGATTTGTTGTGCTGTCGTTCGTGTAGGCGACGTTGGGCGACTGGAGCTTCTCAATGGTTTTGGACGGA
CTCAATGTGGTTATGGAAGTTCGTATCAACGACATGGAGTCTGCTGACGTCCCGAAATATGGTGTGGTTGGACTTTCGCCACGTGCAAGGAGGACGAGCT
AATCAGGATGTACCTGCGTGTGTTATGTGTCATGCTAGACTTCGTGATTGATCGGATCCCGTTCCGTCGCTGGGATGTCTATCGCCGCAAGAAGCACGGG
ATCACTACCGCTACCTATGCCCAGCCGAACGCTCCTTCTGGAAGTACGTTACGGGCGTATATATTCACAGCGTTATATTTTTTTAATGATAGGCATTGTT
GACGTGTGATCAATGTTGTGTGTCAATTAGATGCGTACGGAACGCGCCGGTGGGGGCCTGGCGGAGCGACGCAAAACGAGTCTCAGTCGTCTCACGGCTC
CTTCACGAGTAGCAATCGCGAATCTTTTACCGGTAGCTCTCGAGGATCCTTCACGGGTAGTTCTCCTCCGCCGGATCGTACGCAAAGCTTTGGACAGCAG
GGTGCTCGTCCGCGAACGTCTTCGGGACAGCAGAATGGACGCACTCGCAGCTTTTCGGGACAGCAAAATGAACAGCAAGGGTTTCAGCAGTACGGTGGAC
AGCGCTCATCGTTGCAGGAGCAGAGTGCACCGTTTGCTCCTAACCCTGCGCCTACGAACGCGCACCGTCAGCCACCCCCGGCCCCGGCTGCACCAAAGCC
GAAGAAGCAGCCCGAGATTAATTTGATCGACGACTTTGGCCCCAGCGTGAGCGTGTCGGCACAATCGTTGATTTTCGATCCTTTGGCCAGTGTAAGTGCA
GTTTCACATGAGTATTCGTTTGCACAGCGATGATATATCTCACATCATAATGTTGTGAATCCTAGGCAAAGATCTCAGCGGCTGGAGACTCTGTTGCCAC
AAGCGTACCCGCGCCGCACCAACAGCAACAAGCAGTCCCAGTCGCTTCTATCCCTCAGCAAACCAACTATGTGGACCCGTTTGCTTCTGTCGCTCCACCC
ACACCGACGAAGCCCGCCGGAAACGTCAATTTGGATCCGTTCGCAACTCACAATACCGGCAACTTCCAACATCAACAGCAGCAGCGCCCAACTTCTATGG
GTAATATGACTCAAGCATACACGCAGCAACCTATGGGTATGGCTATGGGTGCGCCTCAGGGTGGAGTGCTGATGCAACAATCTCACCAGCATGGAATGCG
AGGTTCTTTTACAGGGCCGCAGCCCGGTGCTCCCAGTGGCATGGGCAACGTCAACTACAACATTTCGCAACTCATGAACCCGGCAAGCCTCCAAAACGGT
CAGCAGAATCAGCAGGGCAAGTCCATTAACATTGATGCGTTCGCTAGCTTGGGCCGTTAGTGCCAAGCGGCTAACAAGCGATGCACAGACGCATATTTTG
ATGAAGCACCTTTGTTCCTATCGCGTAATATTCGTACGGCGTCGATGTTTACCATTGCCAAGCAGTTCACGTGTTTCCCGATCTATCTGGCTTGTCATCT
GGAGCCTCATCTGTACACGGACATACTCAACCTCAGCTTGCTTCTTGGCCTCGAGATTTTCTTTCACCATTTCAAGGCGCTGGGCATGCTCCAGCTCGAT
GAGCTCGAGCTGTCGTGCGTACTGGGCTGAAAGTACCTGCACGTGGTCCTGCAATCGTTTGTCTGCTTGTACGGTCCACTGCTTCTCCTTCAGTTTGATC
TCGGCGGTGTGGAACGACTGCAGCTCGTTCGTGCGTTTTGTTAAGGTCGCCGGGGCACTCTTCGCTAGCTTACGCGCGGCCGCGATCACCTGGTCGCACA
TTACCAGATGATGTTGCAATTCTTGCTTGCACGCGTCCAGTTCGGCTTGGAACTGCTCAGCCTTGCACGCGGCGTCGTGGTGGTACAGGAAAACACTGCG
CAGCTCGAGCTCCACTTTGCCGAGCAAGCGATCCAAGTTGGCTCGAAGCACGGCAAAGCCCTCGAGCTCTTCGAAGTCCCGGAAATGCACCCGCACGCGA
TCCTGCGCTCGCAGGAAGAGCTGCTCCTCTACGAGCGTCAATCGCACGCTCTGTTGCACTTGCATCCCGCGGGCTGAATCACGCGTGACACAGTAACGAT
TCCCGCGACCGCCGGTTATGAACCGTTATTTCAAGTGCACATGAAAGCCGAAAATGAACGTGTGCTTCAGGTGACAGAAATCGGCTATGGCCTCTATTGG
AATAATTTACACCGCGCAGCAGGTGCGCTGCGACTTGTTCGGTGGAGCGCTGTAGTCGTCGCGCGCCTTCTAGTTTACTGTACGCCACATCCAGTGTCGT
TGGTGCTCCAACGCATGGCCGACGTGTAATTGCGCGTGGCCTTCTCGAGCGCGATGAGGTGCGGGTCGCGGACCTGTAGAGAGCGCATGCAGTCGCAGAG
CTTGAAGAGGTACTCGAAGTTGGGGCCGCTGAAGCCGCTGCGGGTGGCGATCTCCTTGGCCATCTCATCCACAGACGACGGTCCCAGGAAGTCCGAGTTG
GTGGGCGTGGCGATGTACACGAGCGCTTTACGCACCACGCCGTCCTCGCAATGGACATCGACCATTTGGCGGTCGTAGCCGGCCTGCTCGCGGTTGTCGA
GCTTGGTGAGTGTGTCGGCAACCTCCTCGTCCGGCACCTTGTAAAGGCGGCCCCACGTGATGTGGTCGCCCGCCAGGTGCGCGTACTCGTCGTCGAACTT
CTTCATCTCCTCGCGGCTGATGAGCGTCACGACGCGGCCCTTTGCCTCGGGCGAGCCGCGGTGGTCCGGGCTGCCCTGCCAGAAGCGGCGGTGCCAGCCT
TCGACGTAGCCGAACACCGTGTCCTCCGCGGGGAACTCAGTCTTCCAGACAATCGATCCGTAGCCAAAGACCCACATGGTTTCTAAATAGGAGCGGAGGT
CTTGAAGACTAGTAGCTGCTGCTTGATGTTGCCGCGATGGAGGCGAATTCCAGAATGAGCTCGGTGGCAAACAAACGCCCAGCCGGGTTGCCCTATCCTG
GGCCAGGATTACTTGCCCTACCCACACCGTTCGGTTGTTTGAGCAAAAAGCTGCCTCAAGAAAATTCCGCCTTGCTGAGCCTGTGACGCGGTAAATCCCG
GGAAATCTGAGCGAGCGCGGCCCCAGTAAAAACGCACCGGGGGGCATCCTGCGCAGGACCCCGATAGCCGCAGCAGAGTGACCTGCAGTCTCGTGCAAGT
ACCGCAAGACAGCATGTTTATCCGCTCATATTGAGCTCGAGCTCGAGCTGGCCGTTGTGGTCAAAGATATCCACCGGCAGGCAACTCAGGATTGAATCCT
GGCTCTGCAGGCAGCAGTGAGGGCCACTCATACCGAGACGCCATCCGTATCATTTGCCGCAGGACAGCCGCGCCGATCTGCTCGGGCGAAGAGAAGCGGA
GGCGTGACCGGATTGGGCCACGTGCATCGAGAGCGTCCTGCCAGCGAGTGACGTGCACGGCCGACGTTGTGCCAGCCCGGTGCTGTTCAAAAGTCGGTTT
TTTTGCCGGAGCGACGCTTGTTTATGCCTCAACTGTCCTGCTCTGTCCAGTAACGTTTCGGCGACCAATGAGAGAGGCGTATCTTGATGACTAGAGGTGC
ACCTTCACCTTATTTGATCGTACTTAAGAGCGTGGTGGTACCTCTCACGCTGATTGGACATTCCGCTTAGGTACGGTTGGCCAGTGTTCCACCTCCCCAT
CCCCCCTTCAACACCAGAATTGGTGACGATCTCATGGCGGTCACCAACGGAGCCCGAGCGCCGGCGCTGATAGGCCCCCCGCTGGTGCAGAAGACCCGAT
TGGCGACCCCGTGCCGCCGTCACACCCGGATGGACCTCAAGCAGCCGTCGCGTGGTTGTCGCCGCGCTCTTGGTCACTGGAGCGTTAGCGGTACAGCCGA
TCAAGCAAGCCTGCAAGTCGAGGAGGAAGCCGGGCGCGGCGACGCGCAGCGCAGGGCGGTTGACTGCCTTCGTTGACGAAACACGCTGATCGAAGAAGAC
CTCCGACACGCAGTTGCCGACACGCGGTTGCCGCGCTCGCGAAAGAAAATCTGTCAGCGAGGCGAGGACGGTGCAGTCGAGCGGTCGCGGTCACGGTCAC
GAAGTCTGCCACTGTGTAGCACTGCTACAGAAATGTCCCTGGCTGGTCACATGAAATGTTGCCGCGCTCTTGGGTCGATCGGTGCGACCGTGGATGCTCC
AGGCTGGCCGCAATATGACAAGTTTTGCTGGACATTATTTTCTTGGAACATTGGACCGAGAAAACCGGTCAGTGACCGGGTCACAGCCACTGGGGTGCAC
CTCTGAACGAGCTTTCTGTCCACGGAGGTCCGCGCTTTGAAGGCAAATCTTGGTGCAGCGAGCAGCAGCCAATGTCTTCCTCTCACGGCAGTGACTCGAA
CGACGAGGATGAAGAAAAGGAGCAAGCCAGTGTTCATTCCCTCGTTGCCACTCACAACTGGGACAACAGCGTGAGCGCCGTTCGGCCTGAGCTGGCAAGA
TTTGAGACTGCATTCACGTTGACGGCCATCAGACTGACGGTCAGTGACGGTGAGGGCTCAACCCCCCCCCCCCCGAACTCAGATGCTGCAAACCTGAACG
CAGGAGGTCCAGAGACGCAAACCAGCCAGCTAACACCAAGAAACAAAAAACGAGGCAGCAGACAATTGAGCGCGAATCGCGAGAGATTGTTTCTGACGCT
GAAAAATCGCCCACAGTCGCTCTCTCAGCTACTGCACCTCGACCCGATCAGCTCCGGTGGATCATTCAGCAACAGCAGCATACATGTATATCGTATCTCA
ACAGCAGTCAAATGTCCAGCAGCAGGCGCAGGTCAATTATCAGAAGCGACTCAGTCACTACCGGTAGCGTTTCCTGTTACTACAGTAGACGGCGACAGAC
TTTCGCGCTGCTGCAGCCCGATCTATGAATGCTTTACGTCCCTAGGCAACATGCTTGGCTTCATGTACCAACGTAATTCACTGCGCCGGCTCTTGAGTCG
CAGCTAGCGCACCTCAGCCTTCCCGAAGACGCACAGGTATCACTGAGCGTAGCCAGCAACAGGCGGTGGCTAAGTATGCTGACGAAAGAAAACGTGATGA
AGCTCTTGGATTGGGAAAACGGAAAGTCCCTGCTAAGGGTGTCGTGTCGAAGAATAAAAAAACATGCTACTCCGCGCTTTTAGAGCCGATACGCATGACC
TAAAGATTCCTTTATAGTTTCTTTTGGGAGTTTACTTGCAGAGGAACATCATAGATCCGACCGCAAACTTTGTCCGACAGAAATCAGCTTCAAAGAAAAA
AGCGTGACCCACGACTTCGCATGTTGTTCCCCTGAAAACGCCAACGTAGACTGCGAACAGTTAGATGAGCAGCATTTCACTGGAGCTGAAAGTGCTCTAG
CGTGCACGAGCACTTGGTGAACCAAGCATTTGGAGCAGCCTACGTTGATCACGACACAAACATTAACTATCGGATGGCCCAAGCGGATTCTGGTTAGTTT
TATAAATCATCTACATCAGTACAAAACTCCCTGTTTGCTTCATCCAGCATCTAACACACACGTGCTAAGGTGAAACCAAGTGCTTTTGCACAATAATTAT
CAATCGGTATTACTTCGTACTTCAGTATCCTATAGCGATATGATTTCCAAAAAGCGGGGTCAATGAGTTTTAACCTTGGTTGGCGACTTTCAAAGCAAAA
TTGGCTTGAGTGACGAATTGGATCAAATATACATGTAGGAGTGCGTAAGATGGTATGGTTGTCAATTTCTAAACAAATACAAACCGTAGCGACAAGTTGT
TGTAGCTGCAGTAGTTGAAGAAGATATGTTGATGTGCCAGCTTCACGTCAATCGGTGGTCAAAATGCATCTCGAAAGTTGACGTCAGGAAAAGCACTGTT
CAAAATGGGCTTGACTGAAGCCTGCCTTGGTAGCCCAGTTCGTTGATCACTGCTTCGTAGTACTTAACTATTTCAAAAGTGCGTTACAACTCTGTGTGAC
CAAACAATTTAGGTGAGTCAACACTTGATAATTCATCAAACATGCTGCAGTGTTGACGAGACCAAGTTCGAGTCGCAGATCACAAAATGGTCATTGGTGT
TGATAGAACACTCCCTTACACACGCCTTGATATATTGTGGAAGGTATCGTGCTGTGCGAATGCAACCGAGCAATACACTGCAAAGAGCATTCGCTACTGA
GTTATTATTGGAGGAGTTGAGCATCTGAACTTTCGTCGTTCTCGAGTCTTGCTTGCTGGCTGTTGTTTCTTTCAGATCGATCTATGCAGGCCTAGATAGT
GGCATGATGCCCAGTCCAAGCATACAGTTAAACAGTATCCGCGATCTGGTCCGCCTCGCTGGACAAGAAACCCAGCTCGTCCTCTTCGCGGATGGAGGGG
CAGTCGCGCAAAATAGCGTGCGAAATAGCCAGAGCTCCGCTGCATTTATAGTAAAGCACAATATTTAGCAAGCTGACCACATCCGCAGTCCTAGAAATCG
CTAGCACTTACCTGGCCGAGCAGATCGTGAACAGGATGGATCCTCCAAACACGACAATCACAGCGGCGCTCACTGCAAATGCAGTCGCAAAGCATACGCG
TTAGCACATTTCACGCTAGCTACTGAAGAATAGTGCACTAACGTACCACCGAGCATACCGAGCTTCCGCTGGTCGGGTGTAACCGTGCGCCCCATAATCT
TCGTCGGGTTCTCGGGCGACTCATTTGCCGTCGCGCTCGACATGTAAAGCCAAAAGCCTCCGAGGCAGATGAGCACAAAGAGGAAGAACGGGTTCAGCAG
GCTGCACCAAAAGTACAACAGTCAGCAACGCGTCCTCTCATCTCGCTGGCGACGCAATGCACGGCGTCGACGTACATGGTGACGACGCCCACCAGCGCCG
CGGAGATGGCGTAGTTGGCGCTGAAGAACAGCGCGTTCTTGCGGCACCGCGAGGCCAGCACATCGCGGCCAGGCACATTAAACGGCTTCTCTTCGCCTGG
TAGGTCGATCAGCCACAGCATACCAGTTAGCATTGATAGAAAGGGACTAGGATGGAGGAGAGCGGGGAACCGCACCGAGTCCGAAGAACTGGGAGATGCC
GCGCACGTTGCGGATATCGACGGCCTTGACGAGCTGGTTTCTGATCTTCTGCAGCGCGTGCTGCGGCACCTCAATGGTGATGGAGCCCTGGGGCTCGTCG
GACGCGACCTTCATAGCGCTCATGGCAACGGCGGTGCTTGTCTGGTCGTCGAGGGAAAGAGAAGTGGCTTGGGCACAGAGAAACTGTTGGCAGGCTCCGG
TTGGCCAGAATAGCACACAACTAGCGAATCAAAAATAGGCTGAATTGGACCAATCGTTGGCCACCTAAGATCCTGTCCCTGGAGTGATGGTCACGCTTCA
ACTTGCATTCCGCACTCGCTCAATCACCAAGATGCAGACGCGCCGCCAGAGCCTCAAGGCGCCGATGAAGAAGACCTACGAGCTGGACGACTCGCCAGAA
GAGGACAGTGAGTGCGGATGCGCCTGCGCTCGCAGCTTCGACCGACCTCGGCTGGCTGATGGGCAGCTGCAAGAATAGCCGGCGTATACATGGGTCTTAT
ACTAACGTCACGCCATGTCCAGGCTGCTCTTATGATGACAAGGTGGAGCTTGCAGCTAGGAATAGCTGAGTAAACACGGTTGACGTGCTTGCTTTTGTGC
AGGAGAACGCGGTGAATGCAGCGATCCCAGGACGAAACAGCAAGAGGAAGGGCGATTTGGAGTCTCGCTCCGGTCGTGGAGGCCTGTTAAAGCGACAGAA
GACAGAGAATACTGCGAACCAAGAATCACCACCAATATTCGCCTTCAAGACGGCGAAGACCTCGTTTCGCAAAAGGAAGGCGCTCAAGCTCCAGAAGCAG
CTAGAAGATGAGGAGAAGAACAAGAAGCGGATCGACGACTTGGTTGCGTACTTCAAGAACTTGGACGAGCAAAAGCTGGAAAGAGCTTGAGATTGGTTGC
GGTGAGCTCACTCTTTTTTGTAATGCCAAAGTGAGTTGCTGAGCGATAACATCGCTCATGCCGACTGGGCAGTCGCTAGCGCAAGAAGCTGATCGCAATA
GCGAGGACTTTGGTGACGAGTCCGATTCTCTTGCGCCTTCTTCGCCAGCCGGGGAGCGTCGATCGCTACCGTTTCCTTCAGAACATTGAAGACGGCCTCC
TGCGCGATAACCAACCAACTGAAGAATTAGTACACCTCTACAGCTAAAAGAATCGTAAGGCGATTCAAGTTACGTTGTTGTGCGTCCTTGCTTACCTGGA
TGTCGGGCTCAGAATCGTCTAGGTGGACAAAAAGGCAGTCCAACGTGTAATCGATGATTGTTCCTTGGAAATGCTCTATCGGCGCAGCTTTCAAAAAGGT
GGTAAACGTCTGACACGCCGCTTTTCGCACAGTGTCATTGCTGTCATCGAGGCGCTTCAGAATCTCGGCGTAGAGTTGATGAACTGGTTCCTCTGTAGAC
AACAATCACAATAGCTGTTCGTGAGAAATATGCTCCCCCCTTCTGAGAAATAGACGTGCTTCATACCCCCCAAGCACCCAGGCAATGCTACGAATAGATA
TTGCAGCGCAAGGCAGACCAGTTGGCGAGTCTTGGCATCGCTGTCATCCATCGAGGATTTAAGCACAGGCAGCATCTACGATGATAGCAACAGCGCAGGT
ATTAGCACAAGCACTAACAATCAGAGAGGGTACTACCAATACACAAGCATTTACCTGAGGTGCAGTCTCAAACAAGCACGGCTGGTCGGCAATGCCGTGG
CGAAGCAGCGTGTATGCACAAGCAACAGCTACTTTTCTGATGGGTGCAAGTAACAAGTCCAAGCATCAGTACTACAGGAAGATAACCTTACTCAAAGCAT
TTATCACTCACCTAATAGTTGCAGCAACACGCCCTCCACGCCACACGATGTTCGGAATGATAGTTTTCTGGAGCAAAGCAACACTAAATGGCTTAAAGGC
CTGGAAAAGTAGTAAACACAAGTCCATTAGACACGACATGAGCCATGAGCAAAAGCTACGCCGAGTGATAGCGTACCTGGCTGATAGCATCCGTCCCTAG
CATCGTCTCCAATAAAGCAAGGAAAGCGAGCCGGACATCCGCATCTTGAACTGGGTCGAGGTGCACCAAGAAGACGGGCACAATTTTCTTCAAGTTTACA
CCGCATGCCTAAACGAAGCAAACCAAAACGACAAGTTAAAATGGGCTTCTAGCAGAGATACTAGAGCATAGAACGTATTATACCACTCCTCCACGTCGAC
AAAGCGAGTCGAACAGTACGCAACTCGGGTCGCTTTTTTGCCAACTGTTTGCTGCTTCAGTGGGAAGCCTCATAGTATCCAGAAGCTTGCCCATGTAGCG
TGCATAAAGTACCTAAAGTCAACCGAAGCCATGCAAATTAGAGAGTACTTCACCCAAACGAATAAAATGAGACTAACCTCAATAGGCTGCTCAATCTTGA
CAGCCAGATCCAACATAGCTTCGCTTGCCTAATTCCATTCCAACGACAGCGTTAGCACCTTCGCGCATTTCAGACCCAGCAATACGTCGTGCAGGTAGTA
TACCGTCTCATAGGCAACTGATGACTCTGGTGACGCAGCGAGGAGGTGACTCAGCACCCAAAACAGTCGGAAGCAGATCTCATCTTTTTGCGAGAGCAGC
GGTGCAGCAGTCTTAATAATACTCGCGACAACGCCAGCCAATTGATCTTGCAGGTCTGATACTTCAGACTCGCGCAGACCAGCGTCACACAATGCCTCGG
TGATCAGCTAAGCGGTGATCAGCACAATGATAAGAGCGGTTAGTTATAGTCTACGAAAGTTCTTACTGATGGCAATCCGTGCGTACCTCCAGGTGAGCTC
CAATCGTCTTTGTTGTCATGCCTTCGATACTCATACCCAGCAGGACTAAGCCATTCGTGCGGTGCTGCGCGGTATCCTGGCCGGCCAGCCTACCTGCCAC
CATTGGCAGCAAAGAAGCCAAAATCATTTGGGCATCCGCGTAAAACCCGACAACACCTGAGCAAGCCTTCACACTGTTGAAGACGGGTTCCTCGTCGTCA
CGGCACGTCTTGCCTAACGCCGAGAAAACCTTGTCGAGGAATGGGTTCACGTTCTGCTCTAGCAACACCAGGTACGCACTGAGAACTTGTGTGTAGCGTT
CACGCACTTGCACAGTCCAATCCCCCGTTTTCTCGAGAAGAAGCGACAACACCTGCGCTCGAATAGTCACTGCAAGTTTCCGAGCTCCAAGTGGTGGGCG
AGTCTCAAAGAAAAGAGGTGGTGTGTTCTTCGCTGAGTCCATATCCACCTCCATCGGCTCTACATCGTCCGCCTTAACATTTTCATCTTCATCCCGAGCC
TCCCAGATTACTGAAAGTTCATTCAGTTTAACGAGAGATAGCTGCCGAACCTCGGGAGCTTCATCGATGATTCCCGCCAGGAAAATGGGGAAGATGGACG
CTTCATACTGCTGAATCTGCTGGATCTGGGCTAACCACGCAGCCAGCGTGATCACTAGTTGCTTCCTCACGGACGGGGCATGGTCAAATACAACCTTCTC
AACAGCTGGGAGAAGCACCTCCTTGATGAGCTCCGGTAAAGCCTCCGAGCCACAGGGAACCGCAGCTTCCAACGCCTGCAATGCGCATACGCGCACGCGG
CTGTGCTGGTGGCCAAGATTCACAACCATAGGTCGCACAATAGCGCCAATCTGCAAGGCCACGTCGCTCTTCCAAGTCGTCGAAATCAAGATGACGCACT
CTGCTGCCATCTTCTTGGCGTCCGGGAACGGGTCCACCGCCGTCTTGCCCAATGCGTTGGCCAGCTCCGAAATAACGTCACGCAGTGACGTCGCCGATAC
TGTCACTGCTGCAAACTGCTTCAGGAATGCGTGCAGTAGCTGCAGAACGAGCAGGCGGATCTCCTCCGTCGGCTCCGGGTACGGCAGCTTGCCGAGACGC
GCGCTGGACAAAGCCACCAGCTCCTTCAGAGTCGCGTCCGACGGCTCCAGCGCCCCGTTCTCGCACAGGAACAGTAGCGATGTGAGCGCTCGCTCGCGGC
ATTTCTCGACGGCATCGCTTTCGGCGCATTGCAGCAGCGGGCGCTGCAGGTTGGTTACGCACAGAGCGCGCAGCACTCCAGCGGACACCCGCGACGCCTC
ATTCTGCAGTGCGCGGTACAGTTTGTCCGCGGCACGGCGGCGCACACTTCGATCCGGGTCTGCCAGGCAGTTGACGTCACGCTGCATCTTCATGGACAGC
ATGTTGTACGCGGCCTCATCCTCTGGAGACAGCACCATGGCTTGCAAGGTGGCGGCGTCGGATCCAAAATGACCCGCCACTCAAGTCGGCCATACAAAAG
CAAGTGATGTAAGATAGGGCAACTTACGTAAGAACTTTATGTTGCAGCAATGAGGTGGACAGCTTTGTCGGCCCTGAACCGGCAAAGAGATACCATGTAC
ACTGTTAGTTGCTCTATGTGTTTCTGCTGAAACTCATCTACTGTTTGTTGCCTCTATATGAATACGAATTGCTCAGATGCTTCGGACGCTGATTGTAAAA
TCGCCAGGCTTTGCTGAATCGAAGACATGGCTCACTTCTTCTTGCCCTGCACGCGTTTGCGGCCGTTGGCGGTGAGCTCGCGCTTTCGCATGCGGATCTT
GGTCGGGGACACATCGATCATCTCGTCCTCGCCAATGTAGGTCACAACATCTTCCAGGGACATCACGCGGATCGGAGACAGCTTGACGTTCTCGTCCGTG
CCGGCAGCACGCATGTTGGTGAGCTTCTTTTCCTTGGTGGGGTTGATCTCAATGTCCGTAGGGCGGCTGTGCTCACCCACGATCATACCCTCATACACCT
CGTCACCAGGCTTCACGAACATCTCTCCGCGGTCTTCAAGCGTGTTCAACGCGTAAGCCTGTTTCCAGCAAGCCATATTGAGTAAATAGGATTGGGGGCA
CGAACGATCGTACATTTAAGCTATCATCTTCCCGTGCACATGCCTCCAGACGAGGAGATAAGCTTGCCCTTCGACGGAGGAGTAGCCGAGCCTTGGAACG
GTGAGTAGCCGTGGAAAATCGAGTTCAGAATTCCACTTCCGCGAGTGTCAGTCTTGATCTACACATAGGAAACATGATCCAGAGTAAGTCCTTATTCGAG
AAAAGTGCTCGGATTCAACGCATTTACGCACCTCACTGCGGTAGCCCATGAGACAGCGACTGGGAATCTTGAACTGGAGGCGCACTTTGTCGTGCATCTC
CTTGAACTCGATGATCTCACCACCACGGGTCGCCAGCTTGTCAATAACCGTGCCAGAGAAATCGGAGTCGACATCGATCGTCACTTCTTCGATAGGCTCC
AACTTCTGGTTGGTCTCCGGGTCCGTCTGGAAGAGCACCTGGGGGGCTGAGACAGACATCTCAAAGCCCTCACGACGCATTTCTTCAATCAGAATAGCAA
GCTGAAGCTCACCACGGCCGTGCACATCGAAGGCCTCCGACGATTTACTTTGAGAAATGGAGATAGCAACGTTGTTCTGAAGACATCAATACACAATCAT
TCATCAGTGAATCACTCAGCTCAACAAAAAAGTAAGAAAAGCAAGATCCCACTGACCTCGCATTCGCGCTCAAGGCGCTGCTTGATATGAGAAGATGTGA
GGAACTTTCCATCCTTGCCTGCGGTCGGCGCATCGTTCACACCAAACGTCATGGAAATCGTGGGCGGGTCCAGCTGCGGAGAGGGAATCGGCTCCGTCAC
GGCCACGTCAGCGATGGTGTCGGACACATACGCGTTGACACCAGCAATGGTGATAATGTCACCTGTTACAACGAGTTAAGCACAAAACATGAAGTATTAG
CATGCAAACGCCTTCAAGCATAAAAGAGTGATGCTCTCAAACATACCAGCGGTAGCCGACGTGATCTCCGACTTCGAAACACCACGGGTCACGAACATCT
TAGTCACTCTGCCAGTCTCAAGCTTCTTGCTCTCGCGGTTCATCACTTGAATCAAGTCGCCAATCTAGTCAATGGCACAGTGAAAAAGCGCGGCACATTC
AAAAGTCAGTACGAAGTGCAAGAGCATCATCTAGAACGAGCCAAGCCCACCTTGACAGTTCCGGCGTGTACGCGGCCTGTCGCCAGACGGCCGACGTACG
GGTCGTGTCCGATCATTGTGACGGCCATCGCAAACGGTTTGTCGGCGGTGGCTTCTGGAGCAGGCACGTAGCGAGTGATCTCGTCCAGCAACGGCAGCAT
GCTGTCACGCGCCTCACCGTTGTCCAGGTCGTGCACGGCCCAGCCCTGTTTCGCTGACGCATACAGCACAGGAAACTCCAGCTGGTCGTCGTCGGCGTCA
AGCGCCACAAACATGTCGAAGAGCTCGTTCTCCACAGATCCATCCAGACGGCTGGTGTCGCGGTCCACCTTGTTGACAACGACGAGTGGCTTCAGTCCGC
GGTGCAGCGCCTTGGTCAGGACAAACTTGGTCTGCGACATGGGGCCCTCCGTGGCATCCACGACCAGCACCACGCCGTCCACCATACTCAGGATGCGCTC
CACTTCGCCGCCAAAGTCGGCGTGACCGGGCGTGTCCACGATGTTGAGCACGTGGCCGTTGTACTCGACGCGCGTGCACTTGGACATGATGGTGATGCCG
CGCTCGCGCTCCAGGTCAATGGAGTCCATGACACGCTCCTCGGAGAGTGTGTTGCCGCCGTGCTTGAGCAACTGGTCCACCAGCGTGGTCTTGCCGTGGT
CAACGTGCGCCACGATGGCCACGTTGCGGATGTTCTCAGCCGTGACGGCCGAATAGTCGGTGGAGAAGGCGCACGCCAGCGTGGGCGCGCTGCGCTGCAG
TATCGAGCGCTGGCCCGAGCGCGCGCGCGCCAGGGCAGGCAGGCAGGACCGACGGAGCCACATGTCGAGCAGGTGCAAGCGATTGATACACGAGGTCGGG
TGATGTGCGTGTGTGGTGCAGAGGCGTCAGCGACCAGGTGATGTGGACCACGTCACAGTAGTGTGCTTCACGCCATTTCGGTGGTGCAGACCTGGTACTC
TGTACCATCGAATGGATTTGTTTCGCATCAGGCTGCTTGGGGAAACTGAAGCTGCCTCACTTCGTCAAACGGACGAAGCGCGTTTGTCAGCGTGACTCGA
AGGGCCTACTAGTACACACTGCATCTGAGCAGGTGATATTACCGTATGCATGCTTGACAAGTCCGTCTTTTAATAACCTGCGAAGAAAATCGTCAATTGA
CGCGACGGTGACGAAATTCGCGGTGACTCGTTCTGTGAGCAACTCTGTAGCAAGAAGCGACGCGAACCACCGACCATTTATACCGGTCCTTCGCAGTCCT
CTCGTTCCTTTCGCGCGGTCGCTGAGTACAGGTGTCTGCCCTTTGTATCTTGCACCAAGGCTCACAACATCGCGAGGCACCTTTACTAGACTCATCCGAT
TTACCGCAGCCTACAATCAGAAAGCTGCAGCCTGCAGTGCAGGCACTGTCACTTGCGACGACTCTGCTTACTTGCCGCCACCCGGCGGTCAGGTTGGCCG
AGGCAGGACATTGGACGCGCTTACAATCGAGGGAGCTGCGTCGTTCCTTACACTCGAGGGTTCGATTTGGATTAGTGTACACCACACCAGGCGTGTCAAA
TGGCTACCGGTACATGTAATCAGGCGCGTCACGCTGAGCCGAGCCGAGTACGCGGCCGATTCTTGGCCCGCGTTGCACCATGTTGGGGCAAGTGCGTGGC
GGCGAGTCGCCGCTGTCGAGTTCCGCCTCGATTGAGGAGACTGCAGTCATGGCGAGCTCGTTCTCGCTTCGCCATCGGTCTGTGGTGCTTGGAAAACATG
AGCAGGATGCGGCGCCGCGTCTTTGGAGGCCAGTGGCTTCGCATCCTGCGATTTGAAGGACTAACTGCAACCTGCGGCCCGATCTCTGCTCAGAGTCTGA
GCCGCAAACAGCGGATCAAACACGCTCCCCGATCGTTGAGGCTGTCCATAGAGAACCACACAGACGCAGGGCTGCTGCTGCTGCCGCGCCCGCGGGCAGT
TTGTGAATCAAGCGCGGCCAATCGCGGCGGCGCGGGTATGGATAAATCAGGATTGCCCTCCTCTTCCGCGCTTGACATTGGTCTCTGCTGCAATGGCAGC
CAGCAAAAGCCACTTTGCCGCGACATTCGCGCTGCCAATGCCTTCGCTCGGACCGGTGAAAATTCAGAACTGTTTGCGTGCGAAGGTCGGGCCGAGGGAC
CAAACGAAGGGAAGGCGGGGCGGATACATGTGTCCACCCGCCTCGCGGGAGTGCACTACAGGTCGTTTGCTTGGTGCTTGGTAAATAAGCAGTCCTTGAC
CAGTGGTCAAGTCCACCGTCAGCTGCAGATACCACCGTCCCCCCCCCCCCCCACCTTCTAAATTGTCTAGCGGGCCGGCTTTGCCTTGTTGTTTGTATTC
AGCGAGGCGCAAACCCGCAGTCCCGGCCCGGGTTTGTGCGCAGCCTCTATGCGATCCCAGACGTTTGATGCGGAAGATCTGTCCGAGCCTTCATTCCGCA
TTTTGCAGGCCGGCGTTGCCCTTCCTCCTCCTCGAGAGTCCCGAAGAAAGCCTTGTGCGCAATGGGCCGGAGGACCTGCGCGCTGCTGCTGCTGGCGCTC
ACGGCGCTGCTACTGCCCGCGGGCGGCGAGGCATTCCTGCCCATCACACGCCACAACCTCACGGCTCTCCAGAAGCGGTGGATCGACCCGGACACGGACC
CCAAGTTCTACAACCTCTCGGTGCCCGCGGGGCCGCAGAACTTCCCAGACTACGGCGGCAACGCCAGCGAGATGAACGAGTACACGCTCATCTTCTCGGA
CGAGTTCAACAGCTCCAAGCGCTCGTTCGAGGCCGGCTTCGACTCCAAGTGGACGGCCCTCGACATCCGAGATACGACCAACATGGGGCAGCACTACTTC
CTTCCCCAGGCCGTGCAGATCGACAAGGGAAACCTCGTCATCACCACCTCCAAGCCCAAGAAGCGCTACCGCGGCACCAAGTACGTCAGCGGCAGCGTGC
AGACGTGGAACAAGTTCTGTTATACCGGCGGCTACATTGAGGTCAAGGCTATCTTGCCTGGCAAGTGGGGCATCCCCGGCACGTGGCCGGCTATCTGGAT
CATGGGCAACATTGGTCGTGCTCCGTTCCTGGGCTCCCAGGACGGCACGTGGCCGTGGAGCTTCGATGTCTGCGCCCCCTTTGTGGAGAAGACCGAGAAG
GTCAAGCAGAAGATTAGTGCCTGTGGCAACCTGACCAACAAGCACGACAAGAGTTCGTACCCGGAGATGTACGGCTTGAACCCGTTCCAGGGTCGTGGTG
CCACGGAGATTGATGTGATTGAAGCGCAGATTCGCGCCCGCGATGAGCCAGCGTTTATCTCGACGTCGCTGCAGATCCGTCCTAGTCTGTCTGAGGACAT
GCGTCCGGGTTCGGAAACGCTTCCTGCTCCTGGACAATGGTATCAGGGCCTCAAGTTCGGCGAATTCACGCGTATTAACAGCGACTACTATGGTGAGGTT
GGTCTCGACTCAATCTCAGCTTTGACGCAGCTTGAAACCAACGCGTTCAGAGATTTCCACTTGTACCGCCTGGATTGGTCCCCTGGTCCAGAGGGTTACA
TCCGTTGGTGGCTCGACAGTGCCTTCTTGTTTGAAATTCCCGGCTCAGCGCTGAGCAAGTGGGTGGGTGATGTCCCTCCTCGCCAGCTTCCTGTGGAGCC
CAGCTACATTATTCTGAGTACTGCTGTCTCTGAAAAGTTCTCCCCGCCGTGCGATGGTCAGATTTGTGACTCGATATGGCCCTCGAACTTCACGATTGAC
TATGTGCGCGTGTACCAGGGCAAACCGAACCGATACACGTCGGTGGGATGCAACCCAGAGGCGTATCCTACGAATGAATGGATCTACTCGCATCCGGTAG
ACTATGGTCTTCCGTGGTACGGCTCGCTGCGCGTGGACACCATCCTTCTGCAGCTTTTCGCAGTGATTAATGCTCTTGTGGGCTTTTTCATGGCTTTCCG
AGGCACGTCTCACCCGAAGACGATGTCAGCCTACGCTAGCTCGTTGTGGCTTACTGCGTTGTTTTATGGAGCGATAAGTGCAAGCGCCCCAGAAGAATTT
GCCTGGATCCAGACTGCTGTTGCATGCCTGTGTGGTTTCGTGGTCGGTGGTATTTGCTGTCTCGTGTACCCGATTTCGCTAGGTGCGATGCTTGGTTTGT
ATGGTGGCGTAATGATAAGCCAGTTCGTGCCTCTGCTTTCTACGCGGGTGATCACTGCTGTGTTTGTGGGTGTGGGCATCGCGCTGGGGTGTGCGCCGCA
GATCGACACCAAGCACATTGTGATCCTGTCAACGTCTTGGCTGGGCAGTCTGGCGTTTTTGCTATCGATTTCGCTTTGGGTGAGCGAGGGTGACATTGCC
GACAACGCGTGGAACCTCGCTGGCTTTATCCTCAACGGCGACAGTCACGACCATGTTGGTTTTTGCTCGGAGCACTGCTTAGCGATGTATGCGCTTCTTC
TCGTGCTCAGTGCGGTCAGCACAATCTATGGGTATTACTACTTGCGTGGTGTGACATTGCGCCATAACGCGATTAGTGCGCGCAAAGCTAAATTCCCGCA
GGTTTCTGCGAGTTCGGACGCTCGATCGTGGAGACCTGATGAGGAAGTGTCGGGAGCTGAGAAGAACATGACCAACTTCTTTTCACCGAACAAGCTGCCG
CACAACATGCAGCAGTTCAGCACAATTTTCCGCATCGCTGTGAATGTGCAGCGATCTTTTGGATTCCAACTTGACAACTTCCGCAACCAGACAGAGCACA
TCGTAGTGTTGCTCACGAACAACACTCGTAAGAATGGGAACCCGTATCGAAAGCTGCACGATTTGGTGTTTTCTAACTATAACAAGTGGTGCTCGAAGTT
GAGGATTCAACCGCTGCAATGGAGTGAGCAGCGGGCGCCACAGGGAGGCCTTACGAGCGTGGACGAGATCTCGGTGGACTTGTGCCTGTTTTTCTTCATC
TGGGGTGAGACTAGCAACCTGCGCCACTCTCCCGAGTTCTTGTGCTACCTTTTCCATAAGATGAAGGAGGAGTTTCCGTCGGTTCGTCACTCCGAACGCG
AGGCTGGATACTTCCTGGATACGGTGGTAACACCTGTCTACGGCCTGTTGAAGGCTGAGATGATGTCGAAGCACGACCACGAGGACCGCCACAATTACGA
TGACTTCAATGAGTTCTTCTGGACGAAGGCATGCCTGAAATACGACTACAAGCACGAGGAAGTTCTCGACATGACGTCGCCGAGCCCTGCCATGATTTAC
CAGCAGAAGAAAATGCAACGTGAGGGTCTAGGAGGCCTCAGTACCCGAGGTGGGCTGAACGGTGGTTCCAAGAGCGGCAATTTCTTCCAGAAACGCAAGA
GTATTGCTGAGGGATTCACTGAATCGGCGAAGACGTTCGTGGAGAAACGAACATGGTTACTACCGCTGCGCGCCTTCAACCGTATCTTCAATTTCCACGT
GATTTCATTTCACTTGTTGGCAGTTCTCGCTTTTGCTAACGAGCAAGAGATGAACTTTGACGACTTGTGCAAAATCACGTCAAGCACTCTGATCACACCC
TTCTTGCTGGACATTCTGCGTGATGGTCTCGACATCTTCGCAGTGTACCATGTGCACCAGAGAGCGTTTTCGACGGTGCGTAATGTTTTGCGGGTGCTTT
TGCATCTGGCGCTTGTGGTGACGTCGTCAATGCTGTACTGGTACGCTTGGGCGTATGGTGGTCTGTGGTGGCAGACGTACTACGTCGTCACGGTGATTTT
CCACGTGCCTGGGCTGATCAACAGCGTCATGCAAGTCATGCCCGGCCTCACAAACTGGACGCGACGTACTACGTTTGTTCCCATTGCCTTTATCCGTGAT
ATTGTGAGCCCGATGAACCGCCTGTACGTGGGCGACAACGTCTTGGACCCGGAGTCTAAGAGCGTGGGCTACCAGTTTTTCTGGGCTTCGCAGCTTTTAT
GGAAGCTGTACTTCAGCTACAAGTTTGAGATTTCCCCGCTTGTGGTGCCGAGCTTCTTGCTGTATGCCGACCATGTGGAGAATAACGTGAGTATGATTAC
AACGATGTTTCTCATCTTCCTGAACTGGATGCCATTCTTCTTGGTCTTCTGCGTGGATATCACGATTTGGAACTCGATCTGGATGGCTTTCACGGGTACC
TTTGTGGGCTTTTCAGCGCACATTGGCGAAATTCGCAACTTTAGCCGTGTGCGTTCTGCGTTTAGCCGTGCTGTGGATGCGTTCAATGCAAAGGTGATCG
CTCGAAACTCGAAGACTGGACTTCAGATTGCTGAGAGCACGGGAATGTCGTACGGAACAACCGCTGTTGGCCACGAGGTGCTAGATCGCGTTGCAGGTGG
CGCGGACCCGACGTCTCGAATTTTGTCCCAGCGACGTACTTCGGTGCATGATGATGAGACCCCTCTGCTCTCTTTCTCGCGTCGCAAGCAGACACCAATG
GAGCGCCAAGCTGCTCGTCGGCGCAAGTGGTTCTCGTTCTCTATCGCATGGGATACTATTATCGACAGCATGCGCGCGGACGATTTGATCTCGAACAGGG
AGAAGGCTCTGCTTCACTTTCACCGCCTCGATGGTTACCAACGTGAGATTTACCTGCCACAGTTCCAACTGGCTGGTTGCTTCGAAAACTTCACTTCCAG
CATCCTTGACATTTACTCATCTAATGACGGCAAGGTATCGGAACGTGTGTTGCAAGACAAGCTTCTGGAGATTCTCAGTGAAAGTCCGATGGTGGAGGAA
TCCGTCGAAGAGATTTGGGAGCTTGCGAACTGGATGCTTGTCAACGTGCTCGGCCCATGCCACAGCAACGATGTGAAGTACATCACGAGTGTTCTCAACT
CATGGGCAGCACGCGGTGTATTCCGCGCACTTAACCTTCAGAAGGTGGCTCCTTGCGGTCGTGCTTTGGCTAGCTTGGTGTTGTTATTGAAGTCCAACGC
CCGTGCCTGGAAGAACGGCGCCAAGGTTATCCCTGTGCGCAAGGATCCCTCTGATTATGCGTCGTACGAATTCCCGCAGCAGTCGAGCTCGTACCGCCCT
GCTCCGTCGGGCCTTACAAAATCTGCTAGTACGACGGGGTTGTCGTCCTTGGGCCTTGAGCCTCCTCGTCGCAGTCGTGGTTCTGGAGTTGCTCGTATTG
CGCGTATGCAGCAGCAGACGCACAAACCCGCGGTCAACAATGGCAAGGCCACGCACTCAATTCCGAGCGCTCACATCATGCAGATCCGCGAGCGTGTGCG
CACGTTCCTGAACTTAGTGAAGGAAATGCTGGCTCATGTTCACGAGCAAGATCCGGTGTACACGGAGAGCAAGGGTATTTCGGACCGATTGACATGGATT
CTTACGCAAGAGCGCGGTTTCATGTGGGACGATAACTACACGGGTGAACAGATCACGCTGACGTCGTTTGAAAGCCACACGGACGTGGTGCTGTCACACC
TGCATGGACTTCTTACCTTGCAGAAAATTGATGCTGAGCCACAGTCTTACGATGCGCGCCGCCGTCTGCTGTTCTTCGTGAACTCGATGTTTATGGATAT
GCCGTTGGCGCCGTTGCTCGAGGAAATGAAGTCGTGGAGCGTCATGACCCCGTTCTACGCCGAGGACGTGCTGTACTCAAGAAAGGATCTTGAAAGTAAG
CAGGATGGTTTGGATGTGCATACTCTGCTGTTCTTGCAAACGCTGTACAAGCGAGACTGGGAGAACTTCCTGGAACGAGTGAAGCCGAAGAAGAACATCT
GGAAGGATCCAGAGACTGCTATTGAGCTGCGTATGTGGGCTTCCTTGCGTGGCCAGACGCTGTCGCGTACGGTTCAGGGTATGATGTACGGTGAAGCAGC
CATTCGACTGCTTGCGGAGATTGAGCAGGTGCCGCAGCAAAAATTGGAGGAACTGATCAACACGAAGTTTACGTACGTCGTGGCTTGCCAGATTTATGGC
CGCCAGAAGAAGAACAATGACCCGAAGGCGAGTGACATCGAGTTTTTGCTGCACCGCTTTCCGAACCTCCGTGTTGCTTACATCGATGAGGTGCGCGTGA
ACTACCAGAAAGAGCAGTCTTACTTCTCGGTACTCATCAAGGGTGGCGAGGAGCTTGGCTCGGTGCATGAGATCTACCGTGTGCGGCTGCCAGGCAACCC
CATCTTGGGTGAAGGTAAGCCTGAGAACCAGAACTCGGCCATTGTGTTTACTCGTGGCGAAAACTTGCAGACAATTGATATGAACCAAGACGGATACCTC
GAGGAAGGGCTCAAGATGAGAAACCTCCTCGAAGAGTTTGACAAGGGCACAGCTGACCGGCCGTTCACAATCGTGGGCATCCCAGAACACATTTTCACGG
GTAGCGTGAGTTCGCTGGCTAACTACATGGCACTGCAGGAGACGTCCTTCGTGACACTGAGCCAGCGTACACTGGCGCGGCCACTGCGCATGCGTCTGCA
TTACGGCCACCCTGATGTGTTTAACAAGCTCTTCTTCATCACGCGCGGCGGCATTAGCAAGGCCAGCAAGGGCATCAACCTCAGTGAAGATATCTTTGCG
GGCTACAACAATTGTATGCGAGGGGGTTCTGTGACCTTCCCGGAGTACACGAAGGTCGGTAAGGGGCGTGATGTCGGTATGCAGCAGATCTACAAATTTG
AGGCCAAGCTGGCTCAAGGTGCAGCGGAGCAGTCGCTTTCGCGTGATGTGTATCGCATTAGTCAGCGACTGGACTTCTTCAAGCTGCTGTCGTTCTACTA
CAACCACGTGGGCTTCTACCTGTCGACGTCAATCATCATCTGGACCGTTTACATCCTGTTGTATTGCAACCTGCTACGCGCTTTGCTTTCACTTGAGGGT
GTTGGCGGTCGCGAGCCTGTACTGCTGAGCAATTTGCAGCTGATGCTTGGCTCTGTGGCGTTCTTCACGACTGCACCGCTGCTGGCAACGATTTCTGTCG
AGCGCGGCTTTAAGGCTGCACTGAACGAGATTGTGGTCCTCTTCGTCACGGGTGGCCCGCTGTACTTCCTGTTCCACATCGGCACGAAGTGGTTCTACTT
CGGACAGACCATTCTTGCCGGTGGTGCTAAGTACCGTGCGACGGGTCGTGGTTTCGTGACGAAGCACTCGTCTTTCGACGAGCTCTACCGTTTCTACGCC
AGCAGCCACCTGTATGCTGCAGTGGAGATTGCTATTGGACTCACCCTTTACTACAAGTTCACAGTTGGCTTCCAGTACTTATCGACGACGTGGTCGCTGT
GGCTTGTGTTTGTATCTTGGTACTGGTCTCCGTTCTGGTTCAATCCGTTGGCGTTCGAGTGGTCTGACGTGATGGAAGATTTCCGTTTGTGGTTCAAGTG
GATGCGCGGTGACGGTGGCAATCCAGACCAGTCATGGGAGGCGTGGTTCAAGGAAGAGAACGCGTACTTCTCAACGCTCCGTCCGTGGTCCAAGGCGTGC
ATTACGGTCAAGGGTGGATTGTTCGCATTGATCGCGCTCTCTATTTCATCGACGAGTGATGAATATCACTCGATCCTGACTGAGTCGACGTGGCTTCCGT
TGGTAATCTGCTGCTCCATGGCTGCAGTGTACCTTAGTGCCGAGGCAGTCTTCTTTACCTCATCGCGTTCCAACGGTGAGAATGGACTTGTTCGATTCCT
GAAGCTCATATTGGTGCTTGTGCTGGGCGCTGGCCTCATCCTCGCCTTCATTTATGTGGATGGTATGTGGCAGTGTCTGCTGAGCATGGGATACCTCGCT
GCGGCTGTAGGCTGCTGGGCGCTTGTGCTCCTCGGTAGCAACTCGCGTTTGGTTGGCACGCTTTACTTTGTGCACGATGCTGTGCTCGGTTTGGTGTCGT
TGAGTCTCATCCTGTTGCTCGCGGCGCTTTATGTCCCCGGAAAGATCCAAACATGGCTGCTGTACAACAATGCGCTAAGCCGCGGCGTGGTCATCGAGGA
CATCCTCCGAGCCAACTCAAGCAATGACGACCGCGATGACGACCTGTCGGTGCAACAGATGCGCTCGATCATCATGGAGCAGCAACGATTCATCAACGTA
CTGACTGCCAGCGGCAGTGATGCCGACATACGTGCTGCTGGCTCTGGCAAGAAGGAAGACCTCATGCACGCTATGAGCGACAACACGCTTAACGCGGTGT
TGCGGAACATGTCGGAGACGGAACTGAGCGCACTGCAGGACTCATCTAGCCGCCTGCAGGCCATTATGTCGGAGGAAGAACGCAAGGTGGCGCATCGCAA
GAAGCAGCAGGAAGAGCAGAGACTCGTCGAGGCGGGCATGAACCCATCACTGTCGCGCACGCGCCGAGCCTTCTCCACGAGCGATTTTTCGGCCATTCTG
CCGAACGCGAACCCCTTCAACCCCCCGAACCAGAACGGCCCTAGCAATGGTGCTGCCACCAATAACGGCCACACTGCCGTGTAGATAGTTAGACGAACTA
GTAGGTAGAGCCATTGACGATGGCTTGCTTTGCATTTTGAATGAAAGCTACTGTACCTGTTGATGTTCACACTATTCTTTTGTGTTGCGCGCATGCATTG
CATCCTGGTTACGGTGATGTTATGGAGACTTCGCAACCAAGTGATTTTCGGGGATAAAAGAAATTTCAGTGCAGGGCCCATTCAAGCAGCAGGAACGTGC
CAGGTCATGGCAATAGCAAGTGCATGGAAAAGAAGTGAGACCAGAAGAATCCAAGTCTTCAGCCTGGCCATTTGTCATAGCATTATGATGACTACCGATT
CTGCAAAACCAATTCCAGCTCTCTCCAATTGGAGAATTCAATATCAGCACAACCCCTGAAGAACAAGTGAACGGAGGATGGATATTACTGAAAGAAGAAA
AAAAGGCGTTATGGAGTGACAGCGACGAGCATCAGTTTTCCAACCCAAGGCACCAGACACGCCAACGCGGTGAAAATGTTGGACAATGGTCTCCGAGTCT
TCAAACAAATAGGCGACGCAACAAGGACATATCTCCGAATCGACAGTGTGGATAAAACAATTCAGAAGACCCTCAGTGCAAATCCAGACACAACTTCAAA
CACGGGCCACGCCCAGGAACTGGGCTAAGAGCTACAGCGTTTTTTCGATGTACAACGGAGCACACCAGCAAACACGACCTGGAAGCAATTCGGACACTGG
CGAAAACACAATTCTGTCTCCCACAACAAAGAAGAACACCGGATCCGCTGCAGGACTACCTCACCAACTTCACGCAACAAGATTCAGCGCCGCTACGTCA
GACGAATGACGTCTTTTATATTATCAAAAGACTTCTATTGAAAAAAAAACACGTAACAGCAAATAGAAGACCACTTATCATCGCATTGCATTCCTGGTTG
TGTACAGATAGCACAAATGCTTGATTGTTACTACTGTAGTGGTGGATACGCTACGAAACACATACGTCGTACATGTACTTCGCTGAAGTACAGTAGGTAA
ATACACACATAGATTCCATCAGTAGCGTCAGGGCTCTAAGTGCCAGTAGGTAGCAACAGTTTGGCGTCGAGAGCTCAACGATCTATCCATGGATAGCGCG
AATCACTGGTCGGACTGTTTCCTGGGCTTTTTTCCGAAGCCGAGGAACTTCATGTTGGCGCTCAACTTTTTCGACAACGAGTTTTTCTGCAGTGGATCAG
CGCTGGTCAGCACAGCTGCCTTGAAGTTCTCGGTCACCTCGAGATCGCAGTCGCAAGCCTCTAGCTTCTTTTCGATCTCGTCTAGGTTCTTCTCCGAGAC
TGAGCGGATCACTGCCAAATCATCGACAAGCTGCGATGAAGACACGTGGGAGTAGATCTTGCGGCTGTCGGACGCGAAGCACTCGTCGATATCTTGGCTC
GGAGACATGGCCAAATTGGCGAAGAGTTGCTGAATTGCTGGCGAATTCTTCTCAATAAATGGATTGAGCACCCTAGACATAAGTCAATACAACATACATG
TGTTAGAATGCGGCACCAGTAGCAACATTCATCATGTGACGCCGAGCGTACTTGAATTGGGGCTCCCGATCTCCAAACTTTACACCGGTCGCTGTCTTGA
ACAGCAACTTCGTAACTAGCACGAGCACGCGCCGAGTCTCCGGTGGAGGAAGCTGCTTTGTGAGCCCGTACAAATGCGGGGTAGTGATGGCTGGGCACAC
AAATCGAAGGAAGAGGAATCCTCCGATCACCGACCGAGTCAGCGTAGACGCGTCTTCAGCCTCAACGCCCTCCTTTGACCCATCAAATCGACTGATGACC
TTCGAATTCAGATCGGAGCAAATGTGGAAATACGATGACGGGATCTGCGAGTAAAAACAATAAATTTGGACATTAGAAACTCCTCTTGTACATGCCAACG
TCGGAATAAGGTACTTACGCAGTGGGTATTCTTCATGATCGAGTCGATAATGTTCTGGCACGTCTTCATCAGGTTTGCAGCGTTGGAATATGCCTGAGCT
TCGTCCTGGAGTGATTCCTCCTTGTGCGGGTTCAACTCCATCTCGGCAATTTTCAACTTAAATATCTGGTGAATGGGATCTGAGAGTGCCACACGGATAA
ATTTCGACCCGATCGCTTTGCTGTACGTGGAAACGAGTCTGCTCGCATAATCATCTGAGCGGAAAAGTGTAGCCACGTTGATGACTGAAGCCACCTCGAT
TTCGATTGCCCAGCGAATAAGGTGGCTAAGGCGGTTGCGACTGCCAAACACGCGGAGAAACGGAGCTAGTAACAGCATCTTGTCTTCTCGTCCCGCACTC
TGGAGAATAGATGCCACCACAGACATAGTGTCTTCGATTACCAGTGAGGGAAGATCTTTCGGGGTCTGTGGCATTGGTGCCCGTACTGACACCTCAAATT
CCCCGTTCAGAAAATCGCGGGCAGATCTTGCATGGGAAAAAAAATTGCGTATCCTTGGGCTTGCACTGGTACTTGAGCCTGTTGCAGGCGAGCCCGTTCG
TAAAGCACGCTGGTGATGAGCCTCTTCTAGATCGTCCGTTTCCTTTGATGGATCGGTATCAATTCTTTGCCGAATCTCGGCAATAATCTCATCGCTGATC
ACGAGCTGGTCAGGCTGACGTGATTTCTCAGGCTGGGATGACACGATGAAGTCTTTCATGACCTGATGAATCGAGTCAAGAAAGCCGCTCGCCTCCAAAA
ACTGACTGTCAGACTGCAGATTACAATACACATACAGTCAGATTCGAAAGCATGCAACGTAAACAGACTACCGAAAGACGAACCGCATCAAACTCTGACA
GGCGTTCAATCTCGCCCTCCTCGTCGTCATCATAGTAAAGATCGTCTTGTGTGATGGAGAAGATGCTATCATTACTGTCGTTCGAGTTGATTTGATTTAG
ACCAAAATCGGTGACATCTGCAGATGTAAAAAGAAAAAGGAGTTAGAAATCCACTGGAGAATATTTAAGAGCTTCTAGGCGCACCTGAAAAGGAAGTCTG
GGATTCGAGGAGCGATGAGGAGCTTGAGGTGCTTTTCAACGGAGTCTGAAACATAGTAACAAAGCGTGAGTTGGATGTGGACGAACTGTAAATGATAAGA
TGTGACCACCTTACCTTCAATGACTTAGGGTCTACCCGGAAGGAAGACTGCAGATTGCGCGCAATTTCGGCGAGCTCCATCGCCTGTTGCTGTAAAAAGT
CATTTCCAGCGCCGCAACTCGAGTCGAAAATGCCTGCACCAGTGTGTGAGCCCTTAAAACTGGAGGTGAGGGAGCCATCTTCACTGCTTTCACGTGTCGA
TGACGAGTCTGTGAGGTCATCTTTATTCAGGTTGCGCGCCATTTCTGCCAATTCAGCTGCTTGCTGTTGGATGGATTCGTTCTCTGCAGCGTCATTGAAG
TTAGCTGAAGTCGCACTCAACGGATATGTTAGCGACTCTGCAGAAACAGGGCTCGTCTTTTGAGTCGCAGGCGCTGCCACAGCCTCTTGCTTAGGGAGTA
TGGATACTGGCATACATTCCTGGTGAGGAGATGCTGGCTGCTCGTGTCCTGCTTCGGTTTGATCCACTCCATTGTACTGCTCGTCTTCATGGGGCGAAGG
GACCCCCGCGGACTCAACCACCAGGCTCACATTTTGGATATGTTCCCTCCCGTCTTCTCGGCTTATATCACCCTGCGCAGCATCGATACCTTCTACCCCG
TCCTCGTGTTCATCTCCAGGTACTTCGTCATCTTCTGAAAGCACATCAGAAACGGCCGAGCCGCGAGACAACTTGGATATTTCCATCGCAGCGTCGTCCA
GCATGGCATCCAAATCCAACTCTTCTCCATCAGCATCGCCTTCCTTTCCATGACACTCCTTGTCCCCGTCATTTTCTGCTCGTGCCTCCAACTCGTCACT
TCCTTTACGTCCCTGGCGTTCATTCCGTCCTCGATTTTTCACTTCCTTATCTGGCGCTTCAAACACCTCCAGACATTTCTGAAGCTCCTCAATCTCGTGC
CTCTGCTTTTCCACCATCCGCAGAGCATCGCGCAGCATCTCCGACGTCTCCGAGTCGTCTTCACTGGCTCGTTTCCGCCGTCGCGAGAGATGATGTCTTG
GCGACTGCAAGATCACCATCGACGAAGCAGACGTCGACGACGCCGAGCTGGAGGACCTTGACAGTCTCCTGGCTAGAGCGAGCGCCGCCTTGCCGTCCAT
ACTGTTCTTCCTTGTGGCCTCCACATTGCCCGCAGCTTGGCGCAGCTGCTCGATCCATTCCATCCGCGCCTCGTGGGACGGCGCGCGGAAGAGCAGCACG
CGACCACTGCAGGACGTGACTTTCCAGCACGGGCCGCAGTCGTCCCCGCAGTTGGCCGCGTCTCCGTGGCGGAAGATGCGGTCCACGGCCTTGATATCGG
CGTCCACGAGCGGCACAACGGCGCGCGGCCAGTCGCCCAGGTGGGCGTAGTAGTAGAGCGCGTGCGCGTGGATGCCTACGAAGAAGGGCTCCCACGGCGA
CTCGAAGCGCCGGCCTTTCTTGTGCAAAATGCGCAGCGTCGTGCGCTGCTCCAGCTCCAGCCCCGTGAGCAGCAGCTCCGGGCACTTGACGAGCTCCGGT
CGCGGCGAGGAGCTCGGGGTCTCTTCCTCCTCGATGGGGATCTGCACCGTGAGCCGCGAGACGCGGCTGCCGCTCGGGTCGAACACCGACGAGCGCATGA
TGAGGGAGTGCGTGCGTCGAGCGCCAAGTGATGGCGTCTTCGATGCCTCACGCCGGAGAGGAATGGCAGAGTGAGGAAGGGCAACGGCATGTCCGGTGAA
TAGGGCGGCGAACCGGTGCAGTGGGCAGACGGGGCGAGGGGTAATGCACCCCGAATTAGGAGTCCGACACCCGCATTTAGATATGAACGCCCGGCTCTGC
GCTGGAGTCGTCGGTTCGTATCAGACACAGCAGGGCAACATGGCGAAAGAGAGACGACGACGAGCTGCCTGCCCGCGGCATTTGCTTGCCTGGAAATCGT
CGGCAGAGCTGCTGCTCCACGCGGGATAGAATTGCGGAGGTTTGCTTGTCGAGCGGTTCCCTAGATGCGAGCAGATCACCGCGTAGGTTGAAATATCGCG
CTCGTAGTCGCTGGCTTGTCCTCGCGGCGTCGGCGTTCCAATGCGGGCGGCCATAGAAGCCCCGGCGTCTTCGCCGACGCTTTACTGCGAAGCCCACAAC
TCGGTCGTGGGCCACAATCACGAGCAGCGTCGCCGCCGTCGCTGACTCTCCGGCTTTTTTATTTGAGCTCGTTCAGCCCGATCTTTTGGGCGTGCGTCAC
GCACTGCGGGGGGAAACAAGTACCAGTACTTATCTATACAAGTCTTCGCGGTGCGAGTCGCATCTCGTGCCTCACGCATTTCAGCGAGGCGGCCTTTCAC
ATCCCAAGCATTTCGCGAGCCTTTCCAACGCAGCCTCGAAAAAAACTTGGACGAAAGCCAGCCAGCCAGTGCAACGGAGCTCCTTGCCTGTCAGGTTCAG
TAGAGGAGGATGCCGCGTTTTGATATTCGCCAAGCGAGTCTCGGTGGAGTCCTCAACAAACTCGGCTGGGCGGTGATTACCAGCAAAAAGCACCCGTCGA
ACGACTCAATGCATCAATCAACGGCAGCGGCCTCGATCTCTACTGAGCTACTCTCTCCACAGAGAGCGTGACGCCATTCCATCCAGCACAAACAGCCTCA
TGGGTAGCAGCTGCAGCCAGCGAAATGCAAGGCATCAAGGCCTCCAGCTATTCATCGAGCCAAGTGCTCGACTGCTCGTCTACAAGACGTAGCACGAGAA
GTTGCTGCGAAATTGATTCAGCCAATGGGGTGCGTGCATTCGAATTTTGACCAATCGCCAAAACTGCGTAAATTTCTGTGCGCACTTTGTCTCGTACTGC
GAGCGCGGTCCGGTTCGGCGATGCGGTTCGAGAATCGGGCATACAATCAGCAAGTGCTTTGCGGGACCGGTCCCAAGATGAAGCGGAAATGCTGTGCGAT
TTATTTTCTGTGGCCTCCGAGCGCTTGGCTACCAGAGCTCGTCCATTCGGCCCTTTGCCCAGATCAGCAGCATCTTACTCCCGTCTCGCCCGGCAGCCAT
GGTACGTTTCTCACGAGCCTCTTCTCGAGATGGCTGCAGCCCTGCGCGACACGACGCGACGCGGGGGAACCGGGCGACTAAAAGGGGAGACGGCGGACAG
CCCGCCAGCTGCAGCGTCCAGGTGGAAATCAGTGCGATCTTTAGCCCGTGTGGACGCTCGCAATGACGGCGCCTTCCCACTGTCCCCTGTCTTCACGGAG
ATCCTCCTAGTCGCTCCTCCCCGCTGTCCTGCGTGTTCTGTGGCTGCGTTGATTCACATGATACAGACAGACGATTGACTGGATGGTTGGCGCTGTGTGC
ACAGGCCAGCAAGTACCAGAACATCTTCGCCGCCCTCGACTCGGATGACGAGGACACGCCTCGCGTGAACAAGAAGGCCACGCCTCCCCCGTCGGCCCCC
GTCGCTCTGAACAAGCCCGCCGCTGGAAACAAGAAGACTGCCAACAAGTCGGCCCCCGTCGGCGACAAGAAGGAGTCGCGTGGACCGCGTGAGGGTGGCC
GTGCCCCGCGTGACGGCGAGCGTGGCGAGCGTGGTGGCCGTGGCAACCGTGGACCTCGTCGCGAGTTTGAGCGTCGCAGCGGCACAGGCCGTGGAAAGGA
GACCAGCAAGCAGGGCGGTGGTGCCCGCAACTGGGGCAACAAGGCTGATCCCGCCGAGCAGTTGGCTGAGGCCGCTGCCCAGGACAGCGCCAAGCCCGCC
TCGGATGAGGAGGCCACTGAGGAGGTCGCCGCCGTGGAAGAGGAAGAGGAGGAGGTGCAGCTCACCCTCGACGAGTACCTTGCGAAGCAGAAGGAGTCGC
GCTCGGGCGACCTCTTCGCTGACGTGGAGGTGCGCCAGGTGGCCAACGAGTTCTCGAGCGCCGTGCAGATCACCAAGGACGGCAAGACCCCGGACTTCAT
GGACTCGCAGTACGAGAAGGTCTACAGCAAGAAGACCTCTGGCCGCAAGAAACAGCTCATCACCGACGTGGGCTTCCGCACGGAGAAGCCGGAGCGCTTT
ACGCGCGAATTCGACTCGTCGCGTGGCGGCCGTGGTCGTGGCGGCCGTGGTGGTGCTCGTGGCAACGGCCGCACCGGTGGCCGTGGCGGCCGTGGCTCCA
ACGTCCCGAACGTGACGGACATGAGCGCCTTCCCCAGCCTCGGCTAGGGATCGCATCGCGACCAACCGGAATCGCGCGCCCTTGAGCGCCAGCGACATGA
TGAGTGAGATCTTCCACAAGAGGGCTTCTCGAGGACTGGTTTGGCTATCTCTTTTTCTCCTTTTCCCCCGACGAAAGATCCACCGGATAGGGCCTCTGCG
CGGCTGGTGTCTGCCTGACTGTGTGTACCCTCCTGCAGGCAGCCAGCCGTCGTGCGGAAAGTTAGAGAAATTTTTGTTAGCGTGAACTCGGTCTTCTCCT
TGGTATGTCTATTATTCAATGCAGCAGGCTGGGCTTTATGCGAACGAAAATACCGTTTTATCATCCGTGGCCTTTGTTTTACTTTGTTGTTGTTGTTGCG
CGTATCTTCACGAACACGTTGCCGCTTATCTGCAGGACGTTACAGTGACTGATGTTCAGCAATACGACGTGCCTTGACGCTGTCTGGTAGTACTACGATG
GTGCCGTGAGCCGCCCAATAAAAAGGTGTTTGCCGTTGGTTGTCAGTTTCCCACGCTTGAACACCCCAGCCTCACACGGGGGTCGTGCTTCCACGATGAG
CTCGCTTCCTTCGTCATCTTCATCATGTTCCCGAGAGAAAATGCCGCGGCCGGAGGGAAACCCATGAATCCACGTACCAATGAACTTCCGTCCGTCAGGG
GAAGACCACAATCCATAGCCGTGGACCTCGCCCATGCACCATTCGCCGTCGTAGACTTCCCCCGAGGCAAACGTCAGCGCGCCAAACCCATTTCGCTCGC
CAGCTTTATACTCGCCAGCGTACACGCTCCCGCACTGGAAATGGTGCACGCCCTGACCGCTCAGCTCCCCGTCATTCCACATGCCGTGCAGGGAGCCTCC
TGAAAAAATGTACACACCTTTGCCATGCATTAACCCTTGGTGCCACGTGCCTTCGTGCGAGTCTCCACCCACCCACTCATACTTGCCAAACCCTTCGCGC
TCACCCTTCACAAAGTACCCCTCGTACTTGTCCCCCGAGCTGAACACCTTGGTTCCCCACCCGCTCACCTGGTTGTGTCTCCAAGTGCCGTCAACCATTT
CACCTGAGGACAGGAGCTTTTTGCCTTTGCCATGCATATCCCCCTTCTTCCACTCGCCTAAACGAGCAGCACAGCGCACACACGGCTCAAAGGGTGGACA
CACGGACATGGTGTAGATTTTCCTTCTCACCACGATAGCTGTCTCCATTCTTCCAGAAGAAGGTGCCGTTTCCATGCATCTACCATAAGTCTCCCATCAG
CACCCGAATAAAAGTGAGCAAGTACTAAAACCTTTTAAGTACCTTGCCTACTCGCCAATTGCCGACGTACTTGTCCCCATTAGCCCACAGGTACGTCCCA
GTTCCGTGGCGGTGGTTCTTCCGATACATGCCTTCATGGCAGTCTCCAGTACCTGCAAAGGTTTGCATGCCGAACCTGCACCAAAGGCCAACAAAACATT
ATTAGCAGACCAACGCGTTGTCCACCCGTCAGTGACGCTCGCACCCTTCGAAGTCTCCGTGCACCCAGCCACCTTCAAAAATGTGCCCGGATCTCAATAT
GTGGACACCAGTGCCGTGTCGCCTCTCCT