Description :
From Genome Similarity Track
Location :
Scaffold_161:38004- 39691
Transcript NameFunction/comments
Phypl_g4470hypothetical protein

Sequence
1687 bases(100 bases per row)
CCCAACGGTTATCGCTCTTGAGCGGTGTTTCTCAGGCGAAGGATGTTGAAGAGGGCATGAAGACGCCGCAGCCGATTGGCGCCCCGCCTCCAGGTGGACC
GGGCGGAGCTCTGCGCGAACGTGGCATGCCCGTACTGACGAGCAAGGACAACCTCGGTCTGCTCTTCCAATACGCTGCCGTCGGAGTCGTCTACGGCATG
CTGCCGGCGACTATCTATCCGTTCATGCAAGAGCACCTCAACCGTTCGGGCTCCCAAGTCACCGCTGCAGACCAACTTGTGGTGCTCCCGTGGAGTTTCA
AGGTCTTCTACGGCATCTTGTCCGACTGCCGCCCGATCTACGGATACCGTACATGCTGATCGGCTGGAGCATTTGCATTATCATGCTACTTGTTATGGTC
ATTATGCCGATCGGCAAGCCGTACTACACCGTCTCCTCCGATCGCGACATCGACGTATCAGACTACACCACCGAAATCGAAGCACGTATCAATTACGATG
CACCGTCGGAAGGCGCCAAGTACGTGATCCTCATGTTCTTCGCCGCCTTCAGATATGTGATGTCGGACGTCTGTGCCGATAGTATCACGtgcgagctggc
gcagcgcgagccgcTTGACAAGCGTGGCAAAACGCAGTCGTGCATCTACACGGTGCGCACGGCCGTTGTGATTCTGGGCGAAATCATCGTTGGATTCTGC
TTCAACGGCGAGGAATACGGCGGCGATTTCGACTTTTCGTTGAGCTCCCCGCAGTTGATGATCGTCATGGTGGTGCTCACGGTTCCGGTCCTCCCCATGA
CTTGGTTCTTcatcaaggaggagaagaaagAGGCGGCCAACTTCAAGGAGTACATTACCAGTTTCTGGGAACTCCTCTGCAGTCGCGCAGTGTACCAAGT
GATCGCGTACATTTTTTTcagcggcatcttcgcgAACGTCACCTACACGGCCAGCTCCCCCGTGCAGTCGTACATGGTTGGCGTGACACCAATCAACAGC
ACGCTGAGCGACATCCTCAGCAACCTGCTCTTCGCTGCCGGTATCATGATCACGTCCAAGTGGGGCCTGCACTGGAACTGGCGCCTCATGATCGTGCTGA
CCGGCGTGATCGTCATGGTGGTGGACTGTGCGTGCTCCCTGATCACCGTGTGGGACGTCTTCCGCAGTCAATGGTTCTGGCTTGGTCCGCCGATCGCTGT
GGAGCTCCCGTACGGCATTGGGTGGATCATTTCCACGTTCGTGACCGTGGAGTTGGCCGGACTGGGCAACGAAGGAGCGGTGTATGGCTTGATCACGACG
GTTAGCAACATCGCTTCGCCGTTCGCTACGacgttgacgctgctgatcgaTGGCCCGTTCAATATCACGAACGTCCGCGTGCAGACCGACGACCACTCGA
TGCGCGCCGTCATTTCGTACACGATCATCATCATGTACGCGATGACGATTTTCTCGTGGGTCTTCCTGTTTTTGCTACCTAAGCAGGAGGCGGAAacgca
ggagctcgtccgcAAAGGAGGCCACAGCAAGCTTCTGGGTGGAGTCACGGTGTTCTACCTCCTCTTCTCGCTTGTTTGGTCCATCATGACCAATATCATG
GCCATTTTcgacagcacctcgtgcTTGATCATTGCCGGCGGCACAGGTTGCTAAGAGGTAGGAGGGTAAACAGCTTTGGCTGTGCGT