Description :
From Genome Similarity Track
Location :
Scaffold_774:3800- 5605
Sequence
1805 bases(100 bases per row)
GACATTCATGTAAAGCGGAATGTATCCTGTAGAGGCATGGACGGCATTGTTCAAGGCGAACATAACGATGTAGAGCATTGGGCTCCAACGCCGAGGCGTA
TTGGCGCACACGCTGCGTAGGAAGTTTACGAAGATGCGATTAATGCGCTCAGTCTGACCATCGGTCTGCGGATGATCCGCTGTAGATATATCGAGTCTGG
TGCCCAGCACCTTAAAGATGGACTTCTAAAATTTCCCGTGAAACGAGGTTTTCGATCCGAGAGAATTGTCAGTGGCAGTCCGTGTTGTCGTAACACGCCA
TCAATGAAGAGCAAAGCAGTACCTTCACCATCAATCAAATCCGGAACAGCCGCTAAGCGATCCATTTCGGTCAAACGGTCGACAAAAACCACTATACCTG
TGTTGCCGTCCCAAATCCTTTGGTAGACCAAACCCAAAGTCCATGCTGATGGACTCCAACATCCAGAGAGTACAGGAAATATCCAGCGGCGCAGTTGCAT
GAGCCGAGGGTTAGACCCGTAGGCACGTTTCACATGTGCGCACTTAAATGCTTACCCATTTATAGAGTTTCGGGCCACCAATAATTCTGGCTAACTAAGC
CGTAGGTCTTGTCACGACCGAGATGACCGCTAATAGATGTGTCGTGGACCTCATAGAAGATACGATAATTGTTTTCCTTATCATGAGGAGCAATCATACG
CGGGGTATCCGCAATATCCGTGCGATAGCACAACAAGCCGTTATCGATAGAATATCGATGCAGCCTCGCACGAGTACATGTCGACAATTTAATTTCCGAG
TCTTTAAACTCATCTCTTCCAAGAGCACGTAGCAAAGCTACACATTGTTTATCCTTGGCATAAGATGCACGAATTAAGTCAGTAATTGACGACAAAAAGT
CGTAACATGAGCAAGCTCATAGTCAGACAGTCGTGACGGCGCATCAGCCAACGTATTTTGCCTCCCCAGCTTATACTTCACCTTGAAGTTATATTATGCA
AGAATGAAAGCCAACGATCCATCTTCTGTGAGAGGTGAGTCAATTGGGTCGCCGTGCGTAAGAACGCATGATCGGTATGGACCACAAAGGCTTAGAGCCA
AGCAGATGAACTCTGAATTTGACTAGAGCATACTTCATAGCAAGTGGCTCCTTGTCGTGAACTGGATAGTTCTTTTCAGCAGTTTTAAGCTGACGGGATT
CAAAAACGATAACACGCTCGCATCCCTCAACATGGTTGTAACATAGCACAGCCAATGGCACAACGCGAAGCGTCACAGACGACACTGAAAGGGCGATTTG
AATCTGGCAAAGCCAAAATTGGGACATGTAGGAGACTCTCCTTTACTGCCTTAAGATCCTCGTTTTCGGTGCTAGTCCACTACCACTCCATCTCTTTTAA
GGAGATTGGTTAATGGCCGAGCCATATCAGCTTAATTCTCGCTGTATTGTGCAAGTAATTGGCAATGCCAAGCCACTTGCGTAGACCTTTTGATTCTTAG
GAACTGGCCAATCCACTATGGCCTTTACCTTTGCAGAATCCGACCGAATACCTCGCTTCTCAATGAAGCATCCCAAAATGGGATCTCGTCCGCACCAAAG
ATAAATTTTGATGCATTAGCATAGAGCTTATTTGCGCGCCTGCACTCGAGCACAGCTCGTAAATGTTCGATGTGGTTATCCACGTCCGACCGATCATTTT
CCGCTCGACTATGGACAAAAACGTCATCAAATTATGTTTTTTGTGCATATGCACGGTGAGGACGGAACAGTTTCATCTCGCACGATTGAACGTAGCCGGG
ACATT