Description :
From Genome Similarity Track
Location :
scaffold_1040:380- 2056
Transcript NameFunction/comments
g10871.t1 hypothetical protein PHYSODRAFT_508709

Sequence
1676 bases(100 bases per row)
TAAGTGATCACCATTTCGCAGCCATTCACCGTTTTTCTTAGGCAAGAAGAGTTGAAGACTATGAGAAGGACATGGGATATCCGGCTTCTGTATCTTGACC
GCGATCTTCAAGGAGGTCACCGACTCGTTCGCATTGATTTTGACAGAAAATTCGCTCCTTTGGGCACCAACTACGGCGCAGAACAGCTCTAGCCGCACCA
TGTTTTCCACGACGCGGCAAGTTTTGGAATGATGAGAGATTTTCTTTAATCGGAGATGTGGACAATAGTAAATAGGTGGTTAGATTGACAACTTGGGACT
TGATACATTGTCGGACAGAGTTCGAGCCTTCATTGGAAAAACTACAGTAGTTTTGACTGGTCAGATTCTGAAAGATAACTCTTTTTTTTCTTTTGTTCTG
ACCAAGCTTTTTTTCTGTCAATGGAATTGTTCACATCTAAGTACACAGGAACTTCATCAGCAGAATTTTGAAGAATCTCTTGCAGGTCGGCATCGTTGTT
TTTGTAAGCGAAGAGTGAGAAAAATTAGTTCGCCTCGCTTTCTACTGAAATTATCTGGGGATCCCATCAAAAGACAACACAATCAGTATCTTATGGATGA
GGGATCCAAATTCGACGTTCACTCAGTGTGAATGACATGACGGAATGTGTTTTCTTGTAGTCCGCTGCCTAAACTGGTACTGTAAAACTACGACGCGATG
ACAGTAGGTATCCCGTTTACTTCCACACCAACGTCAAAGGTTACGCCAGATATTCCGTTCGTTTAGCAGCCAGTCCCACCCGCAATGATCAAGCACGAGG
TACTATCGAAGATAGCCAAGATGTTGGTCAGGATGGACCACACGAGCGAGAACATGAGGTAGAACACAGTGATTCCACCCAGAAGCTTACTGTGTCCTCC
CTTACGGACGAGCTCCTGTGTCTCCGCCTTCTGCTTGGGTAGTAAAAACAGGAAAACCCAAGAGAAAACCGTCATAGCGTACATGATGATGATCGTGTAG
GTGATATCGGTGCGGATCGAATGATCATCGGTCTGCACACGGACGTTCGTGATATTGAACGGTCCATCGATCAGAAGCGTCAAGGTCGTCGCGAACGGGG
AAGCGATGTTGCTCACCGTCGTAATTAAGCCGTACACTGCGCCTTCATTGCCCAATCCAGCTAACTCTACCGTCACGAATGTGGAAATGATCCATCCAAT
GCCGTACGGGAGTTCCACAGCAATCGGTGGGCCTAGCCAGAACCACTGACTGCGGAAGACGTCCCACACAGTGATCAATGAGCACGCACAGTCCACCACC
ATGACTACGACACCCGTTAGTACGATCATGAAGCGCCAGTTCCAGTGGAGCCCCCACTTGGACGTGATCATGATTCCAGCTGCGAACAGGAGGTTGCTTA
GGATGTCACTCAACGTGCTGTTGATCGGAGTGACGCCGACCATGTACGACTGCACGGGGGAGCTGGCAGTGTACGTGACGTTCGCGAAAATGCCGGAGAA
GAAGATGTACGCGATGACTTGGTACACCGCTCGACTGCAGAGAAGTTCCCAGAAGCTGTTAATGTACACTTTGAAATCCGCCGCCTCTTTCTTCTTCTCC
TTGATGAAAAACCAAGTCATGGGGAGAACCGGCACCGTCAACACGACCATAATGATCATCAATTGAGGGAAGCTAA