Description :
From Genome Similarity Track
Location :
Scaffold_1654:380- 1699
Transcript NameFunction/comments
Phyra_87195PREDICTED: leucine-rich repeat-containing protein 57-like

Sequence
1319 bases(100 bases per row)
GCATTTAGAAAATCGACGGGGAAAAGTACTGAGGCATCAGCAGCGAGACTGAGGAGCTCCTTGGTATTCTGTACAAGTATTCAAATGGGAAAATAAGGCG
TTCGAGGGCATGGGCATCACAGCAAGAGTAAAAGGCGTACCTTGAAAAGCGTAGCGACGCTTGTGACGAGAGCACGCACGCTGTCCGGTTCGGTGTCACT
GTACATCGTTTTAACGGCAACTAACAGTTTGTCGACAGCAGCAGCACGCTCTCGCGCGAATTCCTGTTGAAGTGCCACGACATCTCGCTGAATTTGCTTG
CCGTCCACGTTACGAGCCTCTTTCGGGAACAATTTGGACGCATGCTTGATGAGGAACTTGATGTCGGACAGCTCTGGCAGATGGTTGTAGATTTGGTGCA
CCATACCCTCGACGATTGTGGGGTCGATACGGTCGAAGTAAAGGTTTCGGATCTTCAGCTCGAGGTCGGCGGCTCGCTTTTTGCGCTCGGTAGCCGTTTT
CAGTACGTCAAAGTCGCACCGTATGCGTGTGGCATCGAGCTTTTCAAAGGTGTCATTGGTAAACTCGCCAGGGAAAAGTCGCTCAGTATTGCGCAGCAGC
GAGCGGATGTCGACCGCCTGTGGGAAAAGTTTGAGTACCCGGTGTAGCGTGGAATGAAGCACTGCACTTGCCGCGGCACTGTCGTTGTGGCGCCCGAGGC
GGTACGTTTTGTCGCGGAGCAAGTCGAACAGCTCGCGTTTGAGCTGCTCACGTTCATCTTTGCGCCGCAATTTTCGCAGTATTTGCTGGCACGGCGTTGG
TACTATTTTGACAGGGCTGCCGGTTGTAGTGGAAGCACGCAGGATGTTGTTATCGTTGCTGTCGATCGAGAAAATGAAGGGGTCATCGTCCTCGTTCCTT
CGCAAGACATGGCCCTTCGCCTCCCAGCGGCGTTGTAGTGGTGTGTCATCGATGTTGATCACGCGAAGATGCTGCAAGCGGCCGAGTACTTGTGGCAGTA
TCTCGAGTGCCGAACAGCTGGCATCCAGTACCTGCAATTTGATACAGTAGACGAGTGCACTGGGTAGTTGCTTCAGCCTCGGGTTGTTGTTCACGTAGAG
CTCGCGCAACGCCATCAATGATCCGATCGCGTCGGGAATGGCTTGCGGACCCTCCAGTTGATTGAAGCTTAGATCGAGTCGTACGAGCGTGGCAGCCAAG
TCTCCGGAAGAAGCATTTGAGAAGAGCTCGGGTGGTACGCGTGTGAGTTGGTACTGTATGAGGTGGAGCATGCCATGTTTCTTGGCCTCTTCCACCTGGG
AAGCCACGCTACGCCGACC