Description :
From Genome Similarity Track
Location :
Scaffold_152:38- 3441
Transcript NameFunction/comments
g6764.t1hypothetical protein

Sequence
3403 bases(100 bases per row)
TATCTGCAGGACGCAGCGGAGGGGTGAGGTCGCTTGCGCGAAACCTCACCGAAGAGTTGAACGAAGTGGGTGGTCCCGAACCAGCCAACGGTTACGACGA
AGATGAGTCCGACGATCACCGATCGTCGACGATGGCCGAGGATGCGAATTCTCGGCCGAATGGCGGCCGGCCTCCTCTTAACGGAGACACCCCGGCCGCC
AACCGAGTTCTGGGTCGATACCTAGAACTCATGAAGGTGAAGAGCAACTGGATGCGATCCTTCGCTCCAGAGGTTGTTCGCCAAGCCATCTGGATGGAGC
TCGGTGGCGAGTTAACTGTGCCCGTGGAGTCGTGGAGTACTCGGCAGGTGGCCGAGAGCACGGTGCAACTCCTACGCGCTATGGGATGTGAACCCCAAGG
GTTCCCGTCGGAAGCAGACCTCCGAGCATGGGCACCCGAGGACGCCGCTACGGCGCTTCGCAAGTGGAAGCAGAAGCTTCGGTCGGCCTTCGGGGTGGCC
GAGGCGGGAGTTAGCCGTCCACCGAACGTCCGCCACGCATCGGATCCGGTCGACCCGTCCATGATTCCGTTGCCAACGACCCCTGGGAGACGCCCCAGAG
GGTCGACCGAGGCCGGAATATTTTCAGCCCAAGGTGCGACGTCGACATACTTCCAAGACTCTCACATGGTGACGCCGAGGTCGGTCAGTCGCACAGAACG
ACTGGCGAGAGAGGCCGAGGGATATCGAACCGCTCCGACTGCTGGACGAAGTGCGAATCGGACGCCCAGCCGACGTGACGACCTCCGCGATGACTCATCT
GACGAAGATTCGTTCGACGTCGGAGACACCGGGGGTGACTTGACGGGAGAATGGGCACGCCAAATTCGTGAGCTGAGCGCGGTGGGGAATGACAGTGCGA
CACCGAGGCTAGAGATCGCTACGCATCTCCCACTCGGAAACATTAAGCCGTACTTGGGACTCCGCGATAAGAGCGAGAAATCCATGCAGTGGCTCCGAGC
GTTCATATACGAGATGAAAGGGACGCACACGCCGCCCAACGAATGGTGCATGGCGTTTGAATTGAGCCTCCAAGATGGTGCTCTCCATTGGTACCGACAG
CTGCCCCGCAAAACGAGACGCACGTGGAAATTGTTGAGCGATGCGTTCATTAAATACTACTGCTCGAGGTTCAACCAGTCTGCGAAGGCTCGGTACTACT
CGGCCAAGCGAGAGGAGAAGGAGCATGTCTGCGACTACCTCAACCGACTTAACGGCTATGCTCGCAACGCCGGAGTGCAGTTCGAGCATGGCGGTCGTGA
TGCAAAGGACCACGTCGAGCATTTCTTGGATTCGTGTGAAGACCGAGGTCTAGAAGAGCGTCTGTGCCATGTCCGAGTTAAGAACATTCACGACCTCGAG
GATATGATCAATGATATCCTTCGTCGCAGAGAGCGAAAATCTGGACGCGAGTCCTCGGTCCGCCGCCCTCGAGGGCAAGAGGTAGCACGCCGACGCGATG
GTGGACGCTCCGAGGATCCGCGGGACGGCTATCGCCGAGACCGACGTCACCGAGAGGACGACCGTCGTCGAGAAGACCGTTACCGAGACGATAACCGCCG
CCGGGATGACCAACAATATCGACCGAGGGTCACTCTCACTGACGCACTGACCAACATAGTGACAGCACTGAATGCGGGACGCTCGGTGGACGCGCGTGGA
AGGTACCCAGAAGCGTACAACGACGGATATGATGACACCGAGGAGAATGGGCCGGAGTCTCACTCTGGCGATGACGACCGATACTCCGAAGGGTACTCGG
ACGACGGATACGCGTCGACCGAGGACCGAGGCCACGTTGCTGCTGCAAACGACTCTGAACGTCGCAATGCGGCTGAAGGAGCGTTCGCTCGCGCCGACAA
CCGTCGGCCGAGGGCAAGTAATGGCCAACGCCCGTATGACCGAGACGACCAGCGCCGAAACTCCACCGGACGCGATGGTCGACGCCAATATGGTCCATGC
GCCGCCTGCGGAGGACTCACCCATTCGGCTCACTACTGCTTTAAGCGATGCAAGATGTGCAAGCAGGTTCATGATGCCGGGAAGTGTGAAGCCTTCCAAG
AACTCACGAATCTCCTCCGAGCTAAGGTCGAGAAGAAGGACCTCTCGCCAGAATTGCAGGAACTCGTCTATGGGAGTCATTTAAACTAGGCAGCCCGCCA
ACTGAAACTGGGTTGGTCCCAATCGGGCTGCCACAGTTAGCCAAATCTGCGCTGGATGCGGACTATATGTTCGCATTCGCAGGTGTGAGCAAACGGCCTG
ATGACTTGAATATGGAATATGTGAAAACGACGGAAAATGTAAAGGAGAGAGGCATAAGCCTCGGTGAGAGTGAAGTGAATGGACGACGTGTGGACGGAGA
CGGAGTGGAGCTAACCGATGCTTCGATCCTCAGCATGGCCAAAATCGACCATCCATCCCGAGACCTCGGCCAGACGATTAAACTGTTATCTGGCGAGAGA
ATGGGGTGGTGGTCATCCCAGCGCTATGACAAGAGGAAGCGATTGCGAGCCCTCGTCAATGGGGCTGTAAACGACTCGCGAACGAGGATTCTGCTGGACA
CTGGAGCGAATGTCAGTGTGATTTCCGCGTCATACGCGAAACGGTTGCGCTTGCGCGAAGTTCCAGACCACGGTAGGAGTCTGGAAGTGCGAGGAATTAA
CCCAGGGGTGATGGAGACCCGCAGACGAGCACTCGTTAAAGTCACGCTAGGCTGGGAGCGCGTGTACGAATTTGAAGTATGGGTTATGGATCACAGTGCA
GGAGTGGACGTGGTCCTGGGAACAGACTTCATGATTCCAGCCGGAGTCCGGTTGGATCTGTTCCACGGTACGGCGAGACTACCGGACGAGGTAATGGTGC
CCTTGGTGAAGTCGCCGAACTCAGCAGAGGCTGAGCCGTACAGCATGCAAGTGACTGGACGCCCGACCGAAGATTTGTTGGTCCCAGGGCGTGAGTGGCG
AGAATTTAGGTTACCACGACGACGGCCGCCTCTGACTACTCACGACGTGTGGGCACGCCGGATTGGAAACCTGGTGCCCACTGTAACGAGGTCTCGACGA
GGGCAGCCGAAGATGATGCGACTAACGAACGTGTCACCGAAGATTGCTCACTGCGCGAGACACGAATCGGTGCTGCTGTGGGTGAAAAAGGGTGACCTGC
CGCAAGGGGATGGATACACTCGTTTGAACTCCGCCAAGTATGATGAGTGGCAAGTCCTGGCGTACGCGGAGTGTCGAGACGAGACTTTGTTCGCGCGGGA
ACGCAAACTCTACGAACGGTGGTTGGCAGATCAGCCACCAGCTGTAGAACGACGAGACTATCCGACACCTAGCGGCATCCTACCTCGACCATCCGACGAC
TTG