Description :
From Genome Similarity Track
Location :
Scaffold_2624:38- 2259
Sequence
2221 bases(100 bases per row)
TCCAGATCTGCCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAATCGATTTCGAACAGTTTATTCACCAGTAATCACTGCACAGACGTATATCC
ACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATA
GTTTTTCTCGGAACTGAGGCGCCACCTTCCTCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGG
TAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGG
ATATCATCAATCGTGACCTCCTCTGTGGTCAATGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGT
AACAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGGCCCTCTTTCGCCTGACAGTCCTTCTGTCTTCGGGGAATCAGG
TACCCTGGTATCAGGGAAACCAACAGTTGGATCTAGTCGGTCCTCTAACGAGATTAAGCCCGACGATACTGGTTTGACTAGTGTTGCCACTCTCGATAAG
GATCCAGGCACTTTATCCAATGGAAAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTTCAATCCTTCATCCACCGACC
CTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCG
CGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCTAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACC
AGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCATTCGCTAACCATCGCCCGATCTCCTCATAAT
GGTCCAGTAATAGTCTCTTATCGCTGACTTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCCTGGATTACGGTCGGCACCCGTTTCTCGCCCCGAGT
GACCCACAGTTTCTCATGTTCCACCCACTTCAACCGATCTGGCAGTTCCCAGGTTTCTCCGGGCTCGATCCAGGTCGTCTTATCCGCCCTTATGATCCTC
ATCTTCGCTCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCG
GAACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGAT
CCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCG
GTATCTAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTG
GGGCATGGTACTTCCAGTATCCACGCGACTCCCCGGTTAGCAGATCCATGGATCCAACATCCTCCGATCCACGGGATCCAGTGACCTGACAGACCTTAGG
TGAATCTGCAGTGACCTCACCCTTGGTAGGCTCAAAACATCGACCATGTTGGCGCTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTT
GAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTA
GGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCC
TAGTTTAAAATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGGTTGTAGAATTCTTTCATCGGGCAC
TTGCCGACGTCGTGAATCTCG