Description :
From Genome Similarity Track
Location :
Scaffold_1676:38- 2217
Sequence
2179 bases(100 bases per row)
GGCGGATAGTACACGCCTTCAACAAGTAAGTGCTGCCACTGTACCGGCTCAAACACCAATACCAAGAAAAGATGTCATCGTAGATGGTATGGCTAAGAGT
ACCATCTTTTCATCCATGGATCTGATGGATGGGTTCTATCAGATCCTTATGCACGAAAGGGACATTCCCTATACTGCAGTGAGCACCCCAAGCGGTATGC
TTTGGGAGTGGTTAGTAATGCCACAAAGGCTAAGTAATGCCCCTGCTACATTCAACAGATGTGTAACGAATCTATTAAGATCCGTACGAGAGTTCGCACC
CGGTTACTTCGATGATGTGTTCGTCCATAGCCGGGATAGGGATGGACAGACGGATGTGGAATTGCACCGACTCCACGTCCGGAAAGTTCTTACACTAATG
CGCGATCATAAGTTGTACGCCAACTTCAAGAAGTGTATCTTTGCTGCTAGCGAAATACCACTTCTTGGTTGCATCATGGGCAAGCATGGCGTACGGCCCG
ATCCTGAAAAGATCGAGGCGAATACCGACTGGCCGGTGCCTACAGATGTCAAGGGACTTCGAGAGTTCCTTGGCCTAGCAGCGTATTTGCATAAATATTC
ACGCAATTACGCCGAGATGACTGTTCATCTCTCTCGTTTATCGAAAAAGAACGAGAAGTGGTAATGGAGTGCCGACTGTCAGCGCTCTTTCTAAGGTATC
AAGCAAAGCTTGATATGATCGTCAGTTTTGGCAATTGCAGACCAAGACAGGCCATTCCACGTGGTCTGTGATGCCAGCGACTTGCAATCGGCTATTCATT
TTATGCAGTACGATGCAGACGATGCGGAGCGTGTCGTCTGTTACCAGTCACGCCAGCTACAACCAGCTGAACACAACTACCCCTTCCATGACAAGGAACT
CCTTGACATGAAGTACGCGCTGGCTAAGTTCAGTCTATCTGCTAGGTGATAGACCCTTCATCGTTTTTACGGACCATGCGTCTTTACGCACGGCCGTAAA
CAGTCCACACCTCTCGCAGCGGATGGCGAGGTGGCTGTCATTCTTTGGGGAGTATAACTTTTCCGTCGAGTATAAGCCAGGACGACTTAACGTCGTTGCT
GACGCACTCTCGCGCCGGCGCGATTCCGTGCCGGCTGCGCCACCCGACACTGGTCCGACCACTGTCGCAGTACTGACTTCGAGTGTGCCGTCGTCAACCT
TATTGGAAGACATACGAAAGGCATATGATCCGGAAATGGTGCAATTGATGCATCATCACTCGCACCCATCCGGAAAGAGCCTCAAAAGTTGTCGTAAGTA
TATCGATCCTCTACGGATAGATATACAGTTCGCAACGGCTTACTCCAATATTCGGCTGTTGCCGGCGACACACCTCGTGTCGTCGTATCAGATCATGGTG
ATCTGCAATTGCGTATCATGTATGAGTACCACGACGCACCTGTTGGTGGACATCGTGGTCGTGAGAAACATATCTCACAGTGAGCCGCGACTTTTACTTA
CCCCGCCAGTATCAGTTCGTGCGCAAGTACGTTCGGGACTGTGAGGTCTGTCAACTGGTGAAATCTAGTCCTTCCCTTCGAGCCCCGTTGCAGCCTCTAC
TCGTCCCGGCCGAGTGTTGGGAATCCGTCTCAATGGACCTTGTCTTTGAATTCCCCGAAGACGCTCACAAGAATAATGGTATTATTGTGTTCGTTGACAG
GTTCACCAAGATGGTACATCTGGTTGCTGTACCCGAATCAATCAACGCATCGGCTTGTGCCCGTGTCTTTCTCGACACGGTCTTTCGCCTTCATGGGTTT
CCTCGTAAACTCGTGCCCGATCGGGACCCGCGGTTCACAGTTGAGTTTTGCCGTTCCGAGTTCAAAATACTCGGAACGCGCTTAAAGATGTCCACGTCTG
ACCATCCTAAAACAGATGGTCAGACCTAAAGCGCCAATCATGTCCCCGAGTAGATCCTTCAAGGATACGTCCAATCCTTTACGAATTGGAACGAATTCCT
ATCGATGGTGGAGTTTGCCATCAACAATTCAGTTCATGCGTCGACGGCGCACACACCGTTCTTCGTGATTGGCTTACGCCATCCGCGTCTTTCCACCTTC
TTAGAGTGTGAATCTCGTTAAGGGGGGAGGGAATCATTCGAGCGATCGTCAATCCGGCTCTCACTCGTCACGTGCTGAC